Stem-loop sequence cel-mir-1819

AccessionMI0007981 (change log)
DescriptionCaenorhabditis elegans miR-1819 stem-loop
Literature search

2 open access papers mention cel-mir-1819
(2 sentences)

Stem-loop
   aa   g     a    u      aa     g   uaacuu 
5'   uca ugauc auca gcucaa  cauuc aca      a
     ||| ||||| |||| ||||||  ||||| |||       
3'   agu gcuag uagu cgaguu  guaag ugu      a
   aa   a     g    u      -a     g   uucuuu 
Get sequence
Deep sequencing
4099 reads, 0 reads per million, 17 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

This sequence was erroneously named mir-804 in [1].

Genome context
Coordinates (WBcel235; GCA_000002985.3) Overlapping transcripts
chrX: 16207955-16208035 [+]
intergenic
Clustered miRNAs
< 10kb from cel-mir-1819
cel-mir-2212chrX: 16207829-16207888 [+]
cel-mir-1819chrX: 16207955-16208035 [+]
Database links

Mature sequence cel-miR-1819-5p

Accession MIMAT0020358
Previous IDscel-miR-1819*
Sequence

12 - 

aaucaugcucaaaacauucgaca

 - 34

Get sequence
Deep sequencing5 reads, 4 experiments
Evidence experimental; Illumina [3]

Mature sequence cel-miR-1819-3p

Accession MIMAT0006586
Previous IDscel-miR-1819
Sequence

51 - 

uggaaugauugagcuugaugga

 - 72

Get sequence
Deep sequencing4089 reads, 16 experiments
Evidence experimental; 454 [1], Illumina [2-3]
Database links
Predicted targets

References

1
PMID:18042455 "Systematic identification of C. elegans miRISC proteins, miRNAs, and mRNA targets by their interactions with GW182 proteins AIN-1 and AIN-2" Zhang L, Ding L, Cheung TH, Dong MQ, Chen J, Sewell AK, Liu X, Yates JR 3rd, Han M Mol Cell. 28:598-613(2007).
2
3