Stem-loop sequence cel-mir-1818

AccessionMI0007980 (change log)
DescriptionCaenorhabditis elegans miR-1818 stem-loop
Stem-loop
   cu        u     u   u   c    u  c            cu 
5'   ggaaagag ggccu uug ggu uuca gc augauuuuauca  c
     |||||||| ||||| ||| ||| |||| || ||||||||||||  a
3'   cuuuucuu ucgga agc cca aggu ug uacuaaaauagu  a
   uu        u     c   u   a    u  a            ca 
Get sequence
Deep sequencing
25 reads, 0 reads per million, 7 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

This sequence was erroneously named mir-802 in [1].

Genome context
Coordinates (WBcel235; GCA_000002985.3) Overlapping transcripts
chrI: 13980858-13980954 [-]
intergenic
Database links

Mature sequence cel-miR-1818

Accession MIMAT0006585
Sequence

19 - 

uguggucuucaugccaugauuuu

 - 41

Get sequence
Deep sequencing3 reads, 3 experiments
Evidence experimental; 454 [1]
Predicted targets

References

1
PMID:18042455 "Systematic identification of C. elegans miRISC proteins, miRNAs, and mRNA targets by their interactions with GW182 proteins AIN-1 and AIN-2" Zhang L, Ding L, Cheung TH, Dong MQ, Chen J, Sewell AK, Liu X, Yates JR 3rd, Han M Mol Cell. 28:598-613(2007).