Stem-loop sequence cel-mir-1817

AccessionMI0007979 (change log)
DescriptionCaenorhabditis elegans miR-1817 stem-loop
Stem-loop
   ugu       -aauu    a u   c     c   u        c    uaca 
5'    acauuuc     uucg g agc aaugu uuc cuaucaug auuu    a
      |||||||     |||| | ||| ||||| ||| |||||||| ||||     
3'    uguagag     aagu c ucg uuaua aag gauaguac ugag    a
   -uu       acuuu    c u   u     -   u        a    uaau 
Get sequence
Deep sequencing
235 reads, 9.09 reads per million, 11 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

This sequence was erroneously named mir-801 in [1].

Genome context
Coordinates (WBcel235; GCA_000002985.3) Overlapping transcripts
chrI: 10869370-10869474 [-]
intergenic
Database links

Mature sequence cel-miR-1817

Accession MIMAT0006584
Sequence

21 - 

uagccaaugucuucucuaucaug

 - 43

Get sequence
Deep sequencing232 reads, 11 experiments
Evidence experimental; 454 [1-2], Illumina [3]
Database links
Predicted targets

References

1
PMID:18042455 "Systematic identification of C. elegans miRISC proteins, miRNAs, and mRNA targets by their interactions with GW182 proteins AIN-1 and AIN-2" Zhang L, Ding L, Cheung TH, Dong MQ, Chen J, Sewell AK, Liu X, Yates JR 3rd, Han M Mol Cell. 28:598-613(2007).
2
PMID:18392026 "Discovering microRNAs from deep sequencing data using miRDeep" Friedlander MR, Chen W, Adamidi C, Maaskola J, Einspanier R, Knespel S, Rajewsky N Nat Biotechnol. 26:407-415(2008).
3