Stem-loop sequence vvi-MIR399i

AccessionMI0007963 (change log)
DescriptionVitis vinifera miR399i stem-loop
Gene family MIPF0000015; MIR399
Literature search

4 open access papers mention vvi-MIR399i
(10 sentences)

Stem-loop
   --      ug      uu        c    aggagauggcaauagauuauccuuuguggc 
5'   aguagu  uagggc  cucuccuu uggc                              u
     ||||||  ||||||  |||||||| ||||                              u
3'   ucauca  gucccg  gagaggaa accg                              a
   cu      gu      uu        -    cccaguaaccuucaauuaguuguggccucu 
Get sequence
Deep sequencing
248 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (12X; GCA_000003745.2) Overlapping transcripts
chr2: 4101801-4101922 [+]
intergenic
Database links

Mature sequence vvi-miR399i

Accession MIMAT0006568
Sequence

92 - 

cgccaaaggagaguugcccug

 - 112

Get sequence
Deep sequencing244 reads, 2 experiments
Evidence experimental; Array [2], Illumina [2]

References

1
PMID:17721507 "The grapevine genome sequence suggests ancestral hexaploidization in major angiosperm phyla" Jaillon O, Aury JM, Noel B, Policriti A, Clepet C, Casagrande A, Choisne N, Aubourg S, Vitulo N, Jubin C, Vezzi A, Legeai F, Hugueney P, Dasilva C, Horner D, Mica E, Jublot D, Poulain J, Bruyere C, Billault A, Segurens B, Gouyvenoux M, Ugarte E, Cattonaro Nature. 449:463-467(2007).
2
PMID:19939267 "High throughput approaches reveal splicing of primary microRNA transcripts and tissue specific expression of mature microRNAs in Vitis vinifera" Mica E, Piccolo V, Delledonne M, Ferrarini A, Pezzotti M, Casati C, Del Fabbro C, Valle G, Policriti A, Morgante M, Pesole G, Pe ME, Horner DS BMC Genomics. 10:558(2009).