Stem-loop sequence vvi-MIR399d

AccessionMI0007961 (change log)
DescriptionVitis vinifera miR399d stem-loop
Gene family MIPF0000015; MIR399
Literature search

4 open access papers mention vvi-MIR399d
(10 sentences)

Stem-loop
   --g      aua                      ggcgaucacaagccaaug 
5'    uaaauu   gagcagauuucuuuuggcagau                  u
      ||||||   ||||||||||||||||||||||                  g
3'    auuuaa   cucguuuagaggaaaccgucug                  c
   uca      gug                      ugugaguuacgggaaacu 
Get sequence
Deep sequencing
131 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (12X; GCA_000003745.2) Overlapping transcripts
chr10: 2988021-2988125 [-]
intergenic
Clustered miRNAs
< 10kb from vvi-MIR399d
vvi-MIR399fchr10: 2995807-2995913 [-]
vvi-MIR399echr10: 2992220-2992331 [-]
vvi-MIR399achr10: 2989450-2989546 [+]
vvi-MIR399dchr10: 2988021-2988125 [-]
vvi-MIR399hchr10: 2983545-2983634 [+]
vvi-MIR399gchr10: 2981247-2981359 [-]
Database links

Mature sequence vvi-miR399d

Accession MIMAT0006566
Sequence

75 - 

ugccaaaggagauuugcucgu

 - 95

Get sequence
Deep sequencing131 reads, 2 experiments
Evidence by similarity; MI0002348

References

1
PMID:17721507 "The grapevine genome sequence suggests ancestral hexaploidization in major angiosperm phyla" Jaillon O, Aury JM, Noel B, Policriti A, Clepet C, Casagrande A, Choisne N, Aubourg S, Vitulo N, Jubin C, Vezzi A, Legeai F, Hugueney P, Dasilva C, Horner D, Mica E, Jublot D, Poulain J, Bruyere C, Billault A, Segurens B, Gouyvenoux M, Ugarte E, Cattonaro Nature. 449:463-467(2007).