Stem-loop sequence mml-mir-944

Accession MI0007938
Description Macaca mulatta miR-944 stem-loop
Gene family MIPF0000541; mir-944
Stem-loop
    uu                            u      aaauu 
5' g  ccagacacaucucaucugauauacaaua uuucuu     g
   |  |||||||||||||||||||||||||||| ||||||      
3' u  ggucuguguagaguagacuauauguuau aaagag     u
    gg                            u      aaaaa 
Get sequence
Deep sequencing
1 reads, 0.0898 reads per million, 1 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CR_1.0) Overlapping transcripts
chr2: 184557326-184557413 [+]
antisense
ENSMMUT00000001356 ; FGF12-201; intron 2
Database links

Mature sequence mml-miR-944

Accession MIMAT0006543
Sequence

54 - 

aaauuauuguauaucagaugag

 - 75

Get sequence
Evidence by similarity; MI0005769
Predicted targets

References

1