Stem-loop sequence mml-mir-944

Accession MI0007938
Description Macaca mulatta miR-944 stem-loop
Gene family MIPF0000541; mir-944
Stem-loop
 uu                            u      aaauu 
g  ccagacacaucucaucugauauacaaua uuucuu     g
|  |||||||||||||||||||||||||||| ||||||      
u  ggucuguguagaguagacuauauguuau aaagag     u
 gg                            u      aaaaa 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MMUL1.0) Overlapping transcripts
2: 182150510-182150597 [+]
sense
ENSMMUT00000045251 ; TP63-206; intron 1
ENSMMUT00000023127 ; TP63-205; intron 2
ENSMMUT00000045252 ; TP63-204; intron 3
ENSMMUT00000023126 ; TP63-201; intron 4
ENSMMUT00000045253 ; TP63-203; intron 4
ENSMMUT00000023128 ; TP63-202; intron 4
Database links

Mature sequence mml-miR-944

Accession MIMAT0006543
Sequence

54 - 

aaauuauuguauaucagaugag

 - 75

Get sequence
Evidence by similarity; MI0005769
Predicted targets

References

1