|
miRBase |
|
Stem-loop sequence mml-mir-942 |
|||||
| Accession | MI0007937 | ||||
| Description | Macaca mulatta miR-942 stem-loop | ||||
| Gene family | MIPF0000511; mir-942 | ||||
| Stem-loop |
a uacuca
auua gagaguaccuucucuguuuuggccaugugug c
|||| |||||||||||||||||||||||||||||||
uaau cuuucauggaagagacaaagccggugcacac a
c uccccg
|
||||
| Genome context |
|
||||
| Database links |
|
||||
Mature sequence mml-miR-942 |
|
| Accession | MIMAT0006542 |
| Sequence |
14 - cuucucuguuuuggccaugug - 34 |
| Evidence | by similarity; MI0005767 |
References |
|
| 1 |
PMID:18186931
"Identification of novel homologous microRNA genes in the rhesus macaque genome"
BMC Genomics. 9:8(2008).
|