Stem-loop sequence mml-mir-942

AccessionMI0007937 (change log)
DescriptionMacaca mulatta miR-942 stem-loop
Gene family MIPF0000511; mir-942
Stem-loop
       a                               uacuca 
5' auua gagaguaccuucucuguuuuggccaugugug      c
   |||| |||||||||||||||||||||||||||||||       
3' uaau cuuucauggaagagacaaagccggugcacac      a
       c                               uccccg 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr1: 118171542-118171627 [+]
intergenic
Database links

Mature sequence mml-miR-942-5p

Accession MIMAT0006542
Sequence

14 - 

cuucucuguuuuggccaugug

 - 34

Get sequence
Evidence experimental; Illumina [2]
Predicted targets

Mature sequence mml-miR-942-3p

Accession MIMAT0026915
Sequence

53 - 

cacguggccgaaacagagaagg

 - 74

Get sequence
Evidence experimental; Illumina [2]
Predicted targets

References

1
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).