Stem-loop sequence mml-mir-942

Accession MI0007937
Description Macaca mulatta miR-942 stem-loop
Gene family MIPF0000511; mir-942
Stem-loop
    a                               uacuca 
auua gagaguaccuucucuguuuuggccaugugug      c
|||| |||||||||||||||||||||||||||||||       
uaau cuuucauggaagagacaaagccggugcacac      a
    c                               uccccg 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MMUL1.0) Overlapping transcripts
1: 120066838-120066923 [+]
sense
ENSMMUT00000023746 ; TTF2-201; intron 18
Database links

Mature sequence mml-miR-942-5p

Accession MIMAT0006542
Sequence

14 - 

cuucucuguuuuggccaugug

 - 34

Get sequence
Evidence experimental; Solexa [23034410]
Predicted targets

Mature sequence mml-miR-942-3p

Accession MIMAT0026915
Sequence

53 - 

cacguggccgaaacagagaagg

 - 74

Get sequence
Evidence experimental; Solexa [23034410]

References

1
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).