Stem-loop sequence mml-mir-942

DescriptionMacaca mulatta miR-942 stem-loop
Gene family MIPF0000511; mir-942
    a                               uacuca 
auua gagaguaccuucucuguuuuggccaugugug      c
|||| |||||||||||||||||||||||||||||||       
uaau cuuucauggaagagacaaagccggugcacac      a
    c                               uccccg 
Get sequence
Deep sequencing
114 reads, 7.62 reads per million, 8 experiments
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence mml-miR-942-5p

Accession MIMAT0006542

14 - 


 - 34

Get sequence
Evidence experimental; Illumina [2]
Predicted targets

Mature sequence mml-miR-942-3p

Accession MIMAT0026915

53 - 


 - 74

Get sequence
Evidence experimental; Illumina [2]


PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).