Stem-loop sequence mml-mir-940

Accession MI0007936
Description Macaca mulatta miR-940 stem-loop
Gene family MIPF0000540; mir-940
Stem-loop
          g         cccca         -   gg  -ag  --  gug 
5' guggggu ugggcccgg     ggagcgggg ccu  gc   cc  cc   u
   ||||||| |||||||||     ||||||||| |||  ||   ||  ||   g
3' cacccca guccgggcc     ccucgcccc ggg  cg   gg  gg   u
          -         -----         c   -a  gaa  aa  agu 
Get sequence
Deep sequencing
27 reads, 0.987 reads per million, 6 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CR_1.0) Overlapping transcripts
chr20: 2288681-2288774 [+]
antisense
ENSMMUT00000027028 ; ABCA3-201; intron 18
ENSMMUT00000027029 ; ABCA3-202; intron 19
Clustered miRNAs
< 10kb from mml-mir-940
mml-mir-572 chr20: 2284796-2284890 [-]
mml-mir-940 chr20: 2288681-2288774 [+]
Database links

Mature sequence mml-miR-940

Accession MIMAT0006541
Sequence

60 - 

aaggcagggcccccgcucccc

 - 80

Get sequence
Evidence by similarity; MI0005762
Predicted targets

References

1