Stem-loop sequence mml-mir-940

Accession MI0007936
Description Macaca mulatta miR-940 stem-loop
Gene family MIPF0000540; mir-940
Stem-loop
       g         cccca         -   gg  -ag  --  gug 
guggggu ugggcccgg     ggagcgggg ccu  gc   cc  cc   u
||||||| |||||||||     ||||||||| |||  ||   ||  ||   g
cacccca guccgggcc     ccucgcccc ggg  cg   gg  gg   u
       -         -----         c   -a  gaa  aa  agu 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MMUL1.0) Overlapping transcripts
20: 2271884-2271977 [+]
intergenic
Clustered miRNAs
< 10kb from mml-mir-940
mml-mir-572 20: 2267998-2268092 [-]
mml-mir-940 20: 2271884-2271977 [+]
Database links

Mature sequence mml-miR-940

Accession MIMAT0006541
Sequence

60 - 

aaggcagggcccccgcucccc

 - 80

Get sequence
Evidence by similarity; MI0005762
Predicted targets

References

1