Stem-loop sequence mml-mir-938

AccessionMI0007934 (change log)
DescriptionMacaca mulatta miR-938 stem-loop
Gene family MIPF0000469; mir-938
Stem-loop
   -----------   a         -----------       uaaag 
5'            gaa guguaccau           gugcacu     a
              ||| |||||||||           |||||||     u
3'            uuu cacauggug           cacgugg     g
   ugguucaagaa   c         ucaaguacuuc       ccgaa 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr9: 29728709-29728783 [-]
sense
ENSMMUT00000001949 ; SVIL-201; intron 3
Database links

Mature sequence mml-miR-938

Accession MIMAT0006539
Sequence

15 - 

ugcacuuaaagaugaagccggu

 - 36

Get sequence
Evidence by similarity; MI0005760
Predicted targets

References

1