Stem-loop sequence mml-mir-938

AccessionMI0007934
DescriptionMacaca mulatta miR-938 stem-loop
Gene family MIPF0000469; mir-938
Stem-loop
gaaagugu    u  gca       a  a g -    g  cc 
        acca gu   cuuaaag ug a c cggu ca  u
        |||| ||   ||||||| || | | |||| ||   
        uggu ca   gaauuuc ac u g guca gu  u
--------    u  --a       c  a g u    a  ac 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CR_1.0) Overlapping transcripts
chr9: 29699232-29699306 [-]
sense
ENSMMUT00000001949 ; SVIL-201; intron 3
Database links

Mature sequence mml-miR-938

Accession MIMAT0006539
Sequence

15 - 

ugcacuuaaagaugaagccggu

 - 36

Get sequence
Evidence by similarity; MI0005760
Predicted targets

References

1