Stem-loop sequence mml-mir-937

Accession MI0007933
Description Macaca mulatta miR-937 stem-loop
Gene family MIPF0000560; mir-937
Stem-loop
   -a    -cc c   ---           g  -cu   c ccu 
agc  cugc   c ggu   gagucagggug gg   ggc c   g
|||  ||||   | |||   ||||||||||| ||   ||| |    
ucg  gacg   g cca   cucagucucac cc   ccg g   c
   ag    ucc u   ccu           g  uac   c cuu 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MMUL1.0) Overlapping transcripts
8: 146446870-146446955 [-]
sense
ENSMMUT00000019030 ; SCRIB-201; exon 7
Database links

Mature sequence mml-miR-937

Accession MIMAT0006538
Sequence

51 - 

auccgcacucugacucuccacc

 - 72

Get sequence
Evidence by similarity; MI0005759
Predicted targets

References

1