Stem-loop sequence mml-mir-937

AccessionMI0007933 (change log)
DescriptionMacaca mulatta miR-937 stem-loop
Gene family MIPF0000560; mir-937
Stem-loop
   -----agcacugccccc  u           g  -cu   c ccu 
5'                  gg gagucagggug gg   ggc c   g
                    || ||||||||||| ||   ||| |    
3'                  cc cucagucucac cc   ccg g   c
   ucgaggacguccgucca  u           g  uac   c cuu 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr8: 143078395-143078480 [-]
intergenic
Database links

Mature sequence mml-miR-937

Accession MIMAT0006538
Sequence

51 - 

auccgcacucugacucuccacc

 - 72

Get sequence
Evidence by similarity; MI0005759
Predicted targets

References

1