Stem-loop sequence mml-mir-936

AccessionMI0007932 (change log)
DescriptionMacaca mulatta miR-936 stem-loop
Gene family MIPF0000517; mir-936
Stem-loop
   --------uca     a    gac   -     -    aa  g   -aaa  a u 
5'            aggac cugg   agg agagg gagg  uc cag    uc c c
              ||||| ||||   ||| ||||| ||||  || |||    || |  
3'            uccug gacc   uuc ucuuc uucc  ag guc    ag g c
   agacccggucg     -    -au   a     g    ag  a   aacg  - a 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr9: 99866166-99866263 [-]
intergenic
Database links

Mature sequence mml-miR-936

Accession MIMAT0006537
Sequence

15 - 

acaggagagggaggaaucgcag

 - 36

Get sequence
Evidence by similarity; MI0005758
Predicted targets

References

1