Stem-loop sequence mml-mir-936

Accession MI0007932
Description Macaca mulatta miR-936 stem-loop
Gene family MIPF0000517; mir-936
Stem-loop
--------uca     a    gac   -     -    aa  g   -aaa  a u 
           aggac cugg   agg agagg gagg  uc cag    uc c c
           ||||| ||||   ||| ||||| ||||  || |||    || |  
           uccug gacc   uuc ucuuc uucc  ag guc    ag g c
agacccggucg     -    -au   a     g    ag  a   aacg  - a 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MMUL1.0) Overlapping transcripts
9: 103745990-103746087 [-]
sense
ENSMMUT00000021490 ; COL17A1-202; exon 29
ENSMMUT00000018570 ; COL17A1-203; exon 30
Database links

Mature sequence mml-miR-936

Accession MIMAT0006537
Sequence

15 - 

acaggagagggaggaaucgcag

 - 36

Get sequence
Evidence by similarity; MI0005758
Predicted targets

References

1