Stem-loop sequence mml-mir-934

AccessionMI0007931 (change log)
DescriptionMacaca mulatta miR-934 stem-loop
Gene family MIPF0000542; mir-934
Stem-loop
                       c          a   aua  g 
5' aggaauaaggcuucugucua uacuggagac cug   gu u
   |||||||||||||||||||| |||||||||| |||   || a
3' ucuuuauuccgagggcaggu auggcuucug gac   ca a
                       a          a   --c  a 
Get sequence
Deep sequencing
485 reads, 0 reads per million, 9 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chrX: 130362488-130362570 [+]
sense
ENSMMUT00000024432 ; ZIC3-201; intron 5
Database links

Mature sequence mml-miR-934-5p

Accession MIMAT0006536
Sequence

15 - 

ugucuacuacuggagacacug

 - 35

Get sequence
Deep sequencing22 reads, 6 experiments
Evidence experimental; Illumina [2]
Predicted targets

Mature sequence mml-miR-934-3p

Accession MIMAT0026914
Sequence

51 - 

gagucuucgguaauggacggga

 - 72

Get sequence
Deep sequencing463 reads, 9 experiments
Evidence experimental; Illumina [2]
Predicted targets

References

1
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).