Stem-loop sequence mml-mir-933

Accession MI0007930
Description Macaca mulatta miR-933 stem-loop
Gene family MIPF0000505; mir-933
Stem-loop
--cu     caguuc       -   g g       u ga 
    ugggu      agagguc cuc g gcgcgcg c  g
    |||||      ||||||| ||| | ||||||| |   
    accca      ucuccag ggg c cgugugc g  u
ugac     ---ccc       a   a g       c ac 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MMUL1.0) Overlapping transcripts
12: 38823282-38823357 [-]
sense
ENSMMUT00000005602 ; ATF2-201; intron 1
Database links

Mature sequence mml-miR-933

Accession MIMAT0006535
Sequence

46 - 

ugugcgcagggagaccucuccc

 - 67

Get sequence
Evidence by similarity; MI0005755
Predicted targets

References

1