Stem-loop sequence mml-mir-933

AccessionMI0007930
DescriptionMacaca mulatta miR-933 stem-loop
Gene family MIPF0000505; mir-933
Stem-loop
--cu     caguuc       -   g g       u ga 
    ugggu      agagguc cuc g gcgcgcg c  g
    |||||      ||||||| ||| | ||||||| |   
    accca      ucuccag ggg c cgugugc g  u
ugac     ---ccc       a   a g       c ac 
Get sequence
Deep sequencing
3 reads, 0.521 reads per million, 3 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CR_1.0) Overlapping transcripts
chr12: 38509987-38510062 [-]
sense
ENSMMUT00000030675 ; CHN1-203; intron 2
ENSMMUT00000030674 ; CHN1-202; intron 5
Database links

Mature sequence mml-miR-933

Accession MIMAT0006535
Sequence

46 - 

ugugcgcagggagaccucuccc

 - 67

Get sequence
Evidence by similarity; MI0005755
Predicted targets

References

1