Stem-loop sequence mml-mir-924

AccessionMI0007929
DescriptionMacaca mulatta miR-924 stem-loop
Gene family MIPF0000513; mir-924
Stem-loop
aa    g   u u    uc u   u 
  uaga ucu g guug  u gcu a
  |||| ||| | ||||  | |||  
  aucu aga c caac  a cgg a
--    g   u -    cu c   a 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CR_1.0) Overlapping transcripts
chr18: 33563159-33563207 [-]
intergenic
Database links

Mature sequence mml-miR-924

Accession MIMAT0006534
Sequence

4 - 

agagucuuguguugucuugc

 - 23

Get sequence
Evidence by similarity; MI0005716
Predicted targets

References

1