|
miRBase |
|
Stem-loop sequence mml-mir-924 |
|||||
| Accession | MI0007929 | ||||
| Description | Macaca mulatta miR-924 stem-loop | ||||
| Gene family | MIPF0000513; mir-924 | ||||
| Stem-loop |
aa g u u uc u u uaga ucu g guug u gcu a |||| ||| | |||| | ||| aucu aga c caac a cgg a -- g u - cu c a |
||||
| Genome context |
|
||||
| Database links |
|
||||
Mature sequence mml-miR-924 |
|
| Accession | MIMAT0006534 |
| Sequence |
4 - agagucuuguguugucuugc - 23 |
| Evidence | by similarity; MI0005716 |
| Predicted targets |
|
References |
|
| 1 |
PMID:18186931
"Identification of novel homologous microRNA genes in the rhesus macaque genome"
BMC Genomics. 9:8(2008).
|