Stem-loop sequence mml-mir-924

AccessionMI0007929 (change log)
DescriptionMacaca mulatta miR-924 stem-loop
Gene family MIPF0000513; mir-924
Stem-loop
   aa    g   u u    uc u   u 
5'   uaga ucu g guug  u gcu a
     |||| ||| | ||||  | |||  
3'   aucu aga c caac  a cgg a
   --    g   u -    cu c   a 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr18: 28433712-28433760 [-]
intergenic
Database links

Mature sequence mml-miR-924

Accession MIMAT0006534
Sequence

4 - 

agagucuuguguugucuugc

 - 23

Get sequence
Evidence by similarity; MI0005716
Predicted targets

References

1