Stem-loop sequence mml-mir-922

AccessionMI0007928 (change log)
DescriptionMacaca mulatta miR-922 stem-loop
Gene family MIPF0000536; mir-922
Stem-loop
   -u     --    uc    -c    ----   ggac      cag 
5'   ggcgu  ucuc  ucuc  cugu    ccu    uggggu   a
     |||||  ||||  ||||  ||||    |||    ||||||    
3'   cugca  agag  agag  gacg    gga    gccccg   c
   ug     uc    ua    ac    aaga   ----      ugc 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr2: 204324678-204324757 [-]
intergenic
JSUE03303087.1: 210-289 [-]
intergenic
Database links

Mature sequence mml-miR-922

Accession MIMAT0006533
Sequence

56 - 

gcagcagagaaugagacuacguc

 - 78

Get sequence
Evidence by similarity; MI0005714
Predicted targets

References

1