Stem-loop sequence mml-mir-922

Accession MI0007928
Description Macaca mulatta miR-922 stem-loop
Gene family MIPF0000536; mir-922
Stem-loop
-u     --    uc    -c    ----   ggac      cag 
  ggcgu  ucuc  ucuc  cugu    ccu    uggggu   a
  |||||  ||||  ||||  ||||    |||    ||||||    
  cugca  agag  agag  gacg    gga    gccccg   c
ug     uc    ua    ac    aaga   ----      ugc 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MMUL1.0) Overlapping transcripts
6: 132514810-132514889 [-]
intergenic
Database links

Mature sequence mml-miR-922

Accession MIMAT0006533
Sequence

56 - 

gcagcagagaaugagacuacguc

 - 78

Get sequence
Evidence by similarity; MI0005714
Predicted targets

References

1