Stem-loop sequence mml-mir-892a

Accession MI0007926
Previous IDs mml-mir-892
Description Macaca mulatta miR-892 stem-loop
Gene family MIPF0000386; mir-743
Stem-loop
   --  ag        u        u  -    c  uuac 
5'   gc  ugcucuac uagaaagg gc cagu ac    a
     ||  |||||||| |||||||| || |||| ||    u
3'   cg  augagaug gucuuucc ug guca ug    u
   cu  ga        c        -  u    c  uaca 
Get sequence
Deep sequencing
152 reads, 4.65 reads per million, 5 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CR_1.0) Overlapping transcripts
chrX: 145240904-145240978 [-]
intergenic
Clustered miRNAs
< 10kb from mml-mir-892a
mml-mir-891a chrX: 145244936-145245014 [-]
mml-mir-892b chrX: 145241433-145241509 [-]
mml-mir-892a chrX: 145240904-145240978 [-]
mml-mir-890 chrX: 145238825-145238896 [-]
mml-mir-892c chrX: 145237342-145237398 [-]
Database links

Mature sequence mml-miR-892a

Accession MIMAT0006531
Previous IDs mml-miR-892
Sequence

45 - 

cacuguguccuuucugcguag

 - 65

Get sequence
Evidence by similarity; MI0005528
Predicted targets

References

1