Stem-loop sequence mml-mir-892a

AccessionMI0007926 (change log)
Previous IDsmml-mir-892
DescriptionMacaca mulatta miR-892 stem-loop
Gene family MIPF0000386; mir-743
Stem-loop
   --  ag        u        u  -    c  uuac 
5'   gc  ugcucuac uagaaagg gc cagu ac    a
     ||  |||||||| |||||||| || |||| ||    u
3'   cg  augagaug gucuuucc ug guca ug    u
   cu  ga        c        -  u    c  uaca 
Get sequence
Deep sequencing
242 reads, 0 reads per million, 9 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chrX: 139703810-139703884 [-]
intergenic
Clustered miRNAs
< 10kb from mml-mir-892a
mml-mir-891achrX: 139707844-139707922 [-]
mml-mir-892bchrX: 139704339-139704415 [-]
mml-mir-892achrX: 139703810-139703884 [-]
mml-mir-888chrX: 139702255-139702331 [-]
mml-mir-890chrX: 139701729-139701800 [-]
mml-mir-892cchrX: 139700246-139700302 [-]
Database links

Mature sequence mml-miR-892a

Accession MIMAT0006531
Previous IDsmml-miR-892
Sequence

45 - 

cacuguguccuuucugcguag

 - 65

Get sequence
Deep sequencing238 reads, 9 experiments
Evidence by similarity; MI0005528
Predicted targets

References

1