Stem-loop sequence mml-mir-892a

Accession MI0007926
Previous IDs mml-mir-892
Description Macaca mulatta miR-892 stem-loop
Gene family MIPF0000386; mir-743
Stem-loop
--  ag        u        u  -    c  uuac 
  gc  ugcucuac uagaaagg gc cagu ac    a
  ||  |||||||| |||||||| || |||| ||    u
  cg  augagaug gucuuucc ug guca ug    u
cu  ga        c        -  u    c  uaca 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MMUL1.0) Overlapping transcripts
X: 144125041-144125115 [-]
intergenic
Clustered miRNAs
< 10kb from mml-mir-892a
mml-mir-891a X: 144129075-144129153 [-]
mml-mir-892b X: 144125570-144125646 [-]
mml-mir-892a X: 144125041-144125115 [-]
mml-mir-888 X: 144123486-144123562 [-]
mml-mir-890 X: 144122960-144123031 [-]
mml-mir-892c X: 144121477-144121533 [-]
Database links

Mature sequence mml-miR-892a

Accession MIMAT0006531
Previous IDs mml-miR-892
Sequence

45 - 

cacuguguccuuucugcguag

 - 65

Get sequence
Evidence by similarity; MI0005528
Predicted targets

References

1