Stem-loop sequence mml-mir-891a

AccessionMI0007925
Previous IDsmml-mir-891
DescriptionMacaca mulatta miR-891 stem-loop
Gene family MIPF0000420; mir-891
Stem-loop
c   --a     u     uu  c  a        uucag 
 cuu   auccu gcaac  ac ug gucauuga     u
 |||   ||||| |||||  || || ||||||||     a
 gaa   uggga uguug  ug ac cgguaacu     a
a   aac     u     uu  u  a        uacaa 
Get sequence
Deep sequencing
20 reads, 0.658 reads per million, 3 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CR_1.0) Overlapping transcripts
chrX: 145244936-145245014 [-]
intergenic
Clustered miRNAs
< 10kb from mml-mir-891a
mml-mir-891achrX: 145244936-145245014 [-]
mml-mir-892bchrX: 145241433-145241509 [-]
mml-mir-892achrX: 145240904-145240978 [-]
mml-mir-890chrX: 145238825-145238896 [-]
mml-mir-892cchrX: 145237342-145237398 [-]
Database links

Mature sequence mml-miR-891a

Accession MIMAT0006530
Previous IDsmml-miR-891
Sequence

11 - 

ugcaacuuaccugagucauuga

 - 32

Get sequence
Evidence by similarity; MI0005534
Predicted targets

References

1