Stem-loop sequence mml-mir-891a

Accession MI0007925
Previous IDs mml-mir-891
Description Macaca mulatta miR-891 stem-loop
Gene family MIPF0000420; mir-891
Stem-loop
c   --a     u     uu  c  a        uucag 
 cuu   auccu gcaac  ac ug gucauuga     u
 |||   ||||| |||||  || || ||||||||     a
 gaa   uggga uguug  ug ac cgguaacu     a
a   aac     u     uu  u  a        uacaa 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MMUL1.0) Overlapping transcripts
X: 144129075-144129153 [-]
intergenic
Clustered miRNAs
< 10kb from mml-mir-891a
mml-mir-891a X: 144129075-144129153 [-]
mml-mir-892b X: 144125570-144125646 [-]
mml-mir-892a X: 144125041-144125115 [-]
mml-mir-888 X: 144123486-144123562 [-]
mml-mir-890 X: 144122960-144123031 [-]
mml-mir-892c X: 144121477-144121533 [-]
Database links

Mature sequence mml-miR-891a

Accession MIMAT0006530
Previous IDs mml-miR-891
Sequence

11 - 

ugcaacuuaccugagucauuga

 - 32

Get sequence
Evidence by similarity; MI0005534
Predicted targets

References

1