Stem-loop sequence mml-mir-891a

AccessionMI0007925 (change log)
Previous IDsmml-mir-891
DescriptionMacaca mulatta miR-891 stem-loop
Gene family MIPF0000420; mir-891
Stem-loop
   c   --a     u     uu  c  a        uucag 
5'  cuu   auccu gcaac  ac ug gucauuga     u
    |||   ||||| |||||  || || ||||||||     a
3'  gaa   uggga uguug  ug ac cgguaacu     a
   a   aac     u     uu  u  a        uacaa 
Get sequence
Deep sequencing
39 reads, 0 reads per million, 4 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chrX: 139707844-139707922 [-]
intergenic
Clustered miRNAs
< 10kb from mml-mir-891a
mml-mir-891achrX: 139707844-139707922 [-]
mml-mir-892bchrX: 139704339-139704415 [-]
mml-mir-892achrX: 139703810-139703884 [-]
mml-mir-888chrX: 139702255-139702331 [-]
mml-mir-890chrX: 139701729-139701800 [-]
mml-mir-892cchrX: 139700246-139700302 [-]
Database links

Mature sequence mml-miR-891a

Accession MIMAT0006530
Previous IDsmml-miR-891
Sequence

11 - 

ugcaacuuaccugagucauuga

 - 32

Get sequence
Deep sequencing22 reads, 3 experiments
Evidence by similarity; MI0005534
Predicted targets

References

1