Stem-loop sequence mml-mir-890

AccessionMI0007924 (change log)
DescriptionMacaca mulatta miR-890 stem-loop
Gene family MIPF0000386; mir-743
Stem-loop
   --u   -----     ug      cac       uuag 
5'    gcc     cuacu  gaaagg   caguuac    a
      |||     |||||  ||||||   |||||||    u
3'    cgg     gauga  cuuucc   gucaaug    u
   auu   aauga     gu      cuu       caca 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chrX: 139701729-139701800 [-]
intergenic
Clustered miRNAs
< 10kb from mml-mir-890
mml-mir-891achrX: 139707844-139707922 [-]
mml-mir-892bchrX: 139704339-139704415 [-]
mml-mir-892achrX: 139703810-139703884 [-]
mml-mir-888chrX: 139702255-139702331 [-]
mml-mir-890chrX: 139701729-139701800 [-]
mml-mir-892cchrX: 139700246-139700302 [-]
Database links

Mature sequence mml-miR-890-5p

Accession MIMAT0006529
Sequence

6 - 

uacuuggaaaggcaccaguu

 - 25

Get sequence
Evidence experimental; Illumina [2]
Predicted targets

Mature sequence mml-miR-890-3p

Accession MIMAT0026913
Sequence

41 - 

aacuguucccuuucugaguaga

 - 62

Get sequence
Evidence experimental; Illumina [2]
Predicted targets

References

1
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).