Stem-loop sequence mml-mir-890

Accession MI0007924
Description Macaca mulatta miR-890 stem-loop
Gene family MIPF0000386; mir-743
Stem-loop
--u   -----     ug      cac       uuag 
   gcc     cuacu  gaaagg   caguuac    a
   |||     |||||  ||||||   |||||||    u
   cgg     gauga  cuuucc   gucaaug    u
auu   aauga     gu      cuu       caca 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MMUL1.0) Overlapping transcripts
X: 144122960-144123031 [-]
intergenic
Clustered miRNAs
< 10kb from mml-mir-890
mml-mir-891a X: 144129075-144129153 [-]
mml-mir-892b X: 144125570-144125646 [-]
mml-mir-892a X: 144125041-144125115 [-]
mml-mir-888 X: 144123486-144123562 [-]
mml-mir-890 X: 144122960-144123031 [-]
mml-mir-892c X: 144121477-144121533 [-]
Database links

Mature sequence mml-miR-890-5p

Accession MIMAT0006529
Sequence

6 - 

uacuuggaaaggcaccaguu

 - 25

Get sequence
Evidence experimental; Solexa [23034410]
Predicted targets

Mature sequence mml-miR-890-3p

Accession MIMAT0026913
Sequence

41 - 

aacuguucccuuucugaguaga

 - 62

Get sequence
Evidence experimental; Solexa [23034410]

References

1
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).