|
miRBase |
|
Stem-loop sequence mml-mir-890 |
|||||
| Accession | MI0007924 | ||||
| Description | Macaca mulatta miR-890 stem-loop | ||||
| Gene family | MIPF0000386; mir-743 | ||||
| Stem-loop |
--u ----- ug cac uuag gcc cuacu gaaagg caguuac a ||| ||||| |||||| ||||||| u cgg gauga cuuucc gucaaug u auu aauga gu cuu caca |
||||
| Genome context |
|
||||
| Clustered miRNAs | |||||
| Database links |
|
||||
Mature sequence mml-miR-890 |
|
| Accession | MIMAT0006529 |
| Sequence |
6 - uacuuggaaaggcaccaguu - 25 |
| Evidence | by similarity; MI0005533 |
| Predicted targets |
|
References |
|
| 1 |
PMID:18186931
"Identification of novel homologous microRNA genes in the rhesus macaque genome"
BMC Genomics. 9:8(2008).
|