Stem-loop sequence mml-mir-890

Accession MI0007924
Description Macaca mulatta miR-890 stem-loop
Gene family MIPF0000386; mir-743
Stem-loop
   --u   -----     ug      cac       uuag 
5'    gcc     cuacu  gaaagg   caguuac    a
      |||     |||||  ||||||   |||||||    u
3'    cgg     gauga  cuuucc   gucaaug    u
   auu   aauga     gu      cuu       caca 
Get sequence
Deep sequencing
324 reads, 8.7 reads per million, 8 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CR_1.0) Overlapping transcripts
chrX: 145238825-145238896 [-]
intergenic
Clustered miRNAs
< 10kb from mml-mir-890
mml-mir-891a chrX: 145244936-145245014 [-]
mml-mir-892b chrX: 145241433-145241509 [-]
mml-mir-892a chrX: 145240904-145240978 [-]
mml-mir-890 chrX: 145238825-145238896 [-]
mml-mir-892c chrX: 145237342-145237398 [-]
Database links

Mature sequence mml-miR-890-5p

Accession MIMAT0006529
Sequence

6 - 

uacuuggaaaggcaccaguu

 - 25

Get sequence
Evidence experimental; Illumina [2]
Predicted targets

Mature sequence mml-miR-890-3p

Accession MIMAT0026913
Sequence

41 - 

aacuguucccuuucugaguaga

 - 62

Get sequence
Evidence experimental; Illumina [2]

References

1
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).