Stem-loop sequence mml-mir-889

Accession MI0007923
Description Macaca mulatta miR-889 stem-loop
Gene family MIPF0000514; mir-889
Stem-loop
--     u   g     c      uagua     -  uau 
  gugcu aaa aaugg uguccg     ugguc uc   a
  ||||| ||| ||||| ||||||     ||||| ||   u
  uauga uuu uuacc acaggc     auuag ag   u
cc     u   g     a      -uaua     u  uau 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MMUL1.0) Overlapping transcripts
7: 164332385-164332463 [+]
intergenic
Clustered miRNAs
< 10kb from mml-mir-889
mml-mir-376c 7: 164324189-164324254 [+]
mml-mir-376a-2 7: 164324567-164324646 [+]
mml-mir-654 7: 164324717-164324797 [+]
mml-mir-376b 7: 164324934-164325033 [+]
mml-mir-376a-1 7: 164325280-164325347 [+]
mml-mir-1185-2 7: 164327486-164327544 [+]
mml-mir-1185-1 7: 164328686-164328795 [+]
mml-mir-381 7: 164330417-164330491 [+]
mml-mir-487b 7: 164330952-164331035 [+]
mml-mir-539 7: 164331808-164331885 [+]
mml-mir-889 7: 164332385-164332463 [+]
mml-mir-544 7: 164333144-164333234 [+]
mml-mir-487a 7: 164336378-164336457 [+]
mml-mir-382 7: 164338233-164338308 [+]
mml-mir-134 7: 164338614-164338686 [+]
mml-mir-668 7: 164339183-164339248 [+]
mml-mir-485 7: 164339347-164339419 [+]
mml-mir-323b 7: 164340154-164340210 [+]
Database links

Mature sequence mml-miR-889-5p

Accession MIMAT0026912
Sequence

11 - 

aauggcuguccguaguaugguc

 - 32

Get sequence
Evidence experimental; Solexa [23034410]

Mature sequence mml-miR-889-3p

Accession MIMAT0006528
Sequence

49 - 

uuaauaucggacaaccauugu

 - 69

Get sequence
Evidence experimental; Solexa [23034410]
Predicted targets

References

1
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).