Stem-loop sequence mml-mir-888

AccessionMI0007922 (change log)
DescriptionMacaca mulatta miR-888 stem-loop
Gene family MIPF0000386; mir-743
Stem-loop
   --   agugc   a -  -   a  c          uuau 
5'   ggc     ccu c uc aaa ag ugucagucac    g
     |||     ||| | || ||| || ||||||||||    u
3'   ucg     gga g ag uuu uc acagucagug    u
   ac   --gaa   a u  a   c  c          uaca 
Get sequence
Deep sequencing
3 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chrX: 139702255-139702331 [-]
intergenic
Clustered miRNAs
< 10kb from mml-mir-888
mml-mir-891achrX: 139707844-139707922 [-]
mml-mir-892bchrX: 139704339-139704415 [-]
mml-mir-892achrX: 139703810-139703884 [-]
mml-mir-888chrX: 139702255-139702331 [-]
mml-mir-890chrX: 139701729-139701800 [-]
mml-mir-892cchrX: 139700246-139700302 [-]
Database links

Mature sequence mml-miR-888

Accession MIMAT0006527
Sequence

11 - 

uacucaaaaagcugucaguca

 - 31

Get sequence
Deep sequencing1 reads, 1 experiments
Evidence by similarity; MI0005537
Predicted targets

References

1