Stem-loop sequence mml-mir-888

Accession MI0007922
Description Macaca mulatta miR-888 stem-loop
Gene family MIPF0000386; mir-743
Stem-loop
--   agugc   a -  -   a  c          uuau 
  ggc     ccu c uc aaa ag ugucagucac    g
  |||     ||| | || ||| || ||||||||||    u
  ucg     gga g ag uuu uc acagucagug    u
ac   --gaa   a u  a   c  c          uaca 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MMUL1.0) Overlapping transcripts
X: 144123486-144123562 [-]
intergenic
Clustered miRNAs
< 10kb from mml-mir-888
mml-mir-891a X: 144129075-144129153 [-]
mml-mir-892b X: 144125570-144125646 [-]
mml-mir-892a X: 144125041-144125115 [-]
mml-mir-888 X: 144123486-144123562 [-]
mml-mir-890 X: 144122960-144123031 [-]
mml-mir-892c X: 144121477-144121533 [-]
Database links

Mature sequence mml-miR-888

Accession MIMAT0006527
Sequence

11 - 

uacucaaaaagcugucaguca

 - 31

Get sequence
Evidence by similarity; MI0005537
Predicted targets

References

1