Stem-loop sequence mml-mir-888

Accession MI0007922
Description Macaca mulatta miR-888 stem-loop
Gene family MIPF0000386; mir-743
Stem-loop
   --   agugc   a -  -   a  c          uuau 
5'   ggc     ccu c uc aaa ag ugucagucac    g
     |||     ||| | || ||| || ||||||||||    u
3'   ucg     gga g ag uuu uc acagucagug    u
   ac   --gaa   a u  a   c  c          uaca 
Get sequence
Deep sequencing
6 reads, 1.03 reads per million, 1 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence mml-miR-888

Accession MIMAT0006527
Sequence

11 - 

uacucaaaaagcugucaguca

 - 31

Get sequence
Evidence by similarity; MI0005537
Predicted targets

References

1