Stem-loop sequence mml-mir-887

AccessionMI0007921
DescriptionMacaca mulatta miR-887 stem-loop
Gene family MIPF0000554; mir-887
Stem-loop
---      u        --  -      ag    ug auu 
   ugcaga ccuuggga  gc ccuguu  acuc  g   u
   |||||| ||||||||  || ||||||  ||||  |   u
   acguuu ggagcccu  cg gggcaa  ugag  u   a
gac      c        ac  c      -g    gu cac 
Get sequence
Deep sequencing
956 reads, 16.4 reads per million, 8 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CR_1.0) Overlapping transcripts
chr6: 16253917-16253994 [+]
intergenic
Database links

Mature sequence mml-miR-887

Accession MIMAT0006526
Sequence

47 - 

gugaacgggcgccaucccgagg

 - 68

Get sequence
Deep sequencing2 reads, 2 experiments
Evidence by similarity; MI0005562
Predicted targets

References

1