|
miRBase |
|
Stem-loop sequence mml-mir-887 |
|||||
| Accession | MI0007921 | ||||
| Description | Macaca mulatta miR-887 stem-loop | ||||
| Gene family | MIPF0000554; mir-887 | ||||
| Stem-loop |
--- u -- - ag ug auu ugcaga ccuuggga gc ccuguu acuc g u |||||| |||||||| || |||||| |||| | u acguuu ggagcccu cg gggcaa ugag u a gac c ac c -g gu cac |
||||
| Genome context |
|
||||
| Database links |
|
||||
Mature sequence mml-miR-887 |
|
| Accession | MIMAT0006526 |
| Sequence |
47 - gugaacgggcgccaucccgagg - 68 |
| Evidence | by similarity; MI0005562 |
| Predicted targets |
|
References |
|
| 1 |
PMID:18186931
"Identification of novel homologous microRNA genes in the rhesus macaque genome"
BMC Genomics. 9:8(2008).
|