Stem-loop sequence mml-mir-885

Accession MI0007919
Description Macaca mulatta miR-885 stem-loop
Gene family MIPF0000532; mir-885
Stem-loop
--   ca    c           a  -         cu 
  ccg  cucu uccauuacacu cc cugccucuu  c
  |||  |||| ||||||||||| || |||||||||   
  ggc  gaga aggugaugugg gg gacggagag  c
ug   ac    u           -  c         ua 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MMUL1.0) Overlapping transcripts
2: 50630819-50630892 [+]
sense
ENSMMUT00000028009 ; ATP2B4-201; intron 4
ENSMMUT00000028011 ; ATP2B4-203; intron 4
ENSMMUT00000028012 ; ATP2B4-204; intron 4
ENSMMUT00000028013 ; ATP2B4-202; intron 4
Database links

Mature sequence mml-miR-885-5p

Accession MIMAT0006522
Sequence

11 - 

uccauuacacuacccugccucu

 - 32

Get sequence
Evidence by similarity; MI0005560
Predicted targets

Mature sequence mml-miR-885-3p

Accession MIMAT0006523
Sequence

43 - 

aggcagcgggguguaguggaua

 - 64

Get sequence
Evidence by similarity; MI0005560
Predicted targets

References

1