Stem-loop sequence mml-mir-877

Accession MI0007918
Description Macaca mulatta miR-877 stem-loop
Gene family MIPF0000392; mir-877
Stem-loop
gcuagagaa  ua      au  c c          -gg  aagacuc       c 
         gg  gaggag  gg g aggggacacg   cu       ggggguu c
         ||  ||||||  || | ||||||||||   ||       ||||||| u
         cc  cuccuc  cc c ucuccugugu   ga       cucccag g
guaugugga  --      --  u u          aca  -------       g 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MMUL1.0) Overlapping transcripts
4: 30166012-30166114 [+]
sense
ENSMMUT00000002658 ; MMU.17311-202; 3'UTR (exon 13)
ENSMMUT00000002661 ; MMU.17311-201; 3'UTR (exon 14)
Database links

Mature sequence mml-miR-877-5p

Accession MIMAT0006521
Sequence

11 - 

guagaggagauggcgcaggg

 - 30

Get sequence
Evidence experimental; Solexa [23034410]
Predicted targets

Mature sequence mml-miR-877-3p

Accession MIMAT0026911
Sequence

77 - 

ccucuucucccuccuccca

 - 95

Get sequence
Evidence experimental; Solexa [23034410]

References

1
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).