Stem-loop sequence mml-mir-877

Accession MI0007918
Description Macaca mulatta miR-877 stem-loop
Gene family MIPF0000392; mir-877
Stem-loop
   gcuagagaa  ua      au  c c          -gg  aagacuc       c 
5'          gg  gaggag  gg g aggggacacg   cu       ggggguu c
            ||  ||||||  || | ||||||||||   ||       ||||||| u
3'          cc  cuccuc  cc c ucuccugugu   ga       cucccag g
   guaugugga  --      --  u u          aca  -------       g 
Get sequence
Deep sequencing
2693 reads, 41.7 reads per million, 8 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence mml-miR-877-5p

Accession MIMAT0006521
Sequence

11 - 

guagaggagauggcgcaggg

 - 30

Get sequence
Deep sequencing 52 reads, 5 experiments
Evidence experimental; Illumina [2]
Predicted targets

Mature sequence mml-miR-877-3p

Accession MIMAT0026911
Sequence

77 - 

ccucuucucccuccuccca

 - 95

Get sequence
Evidence experimental; Illumina [2]

References

1
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).