Stem-loop sequence mml-mir-876

AccessionMI0007917 (change log)
DescriptionMacaca mulatta miR-876 stem-loop
Gene family MIPF0000430; mir-876
Stem-loop
   u    ug         u                aucuaa  u 
5'  gaag  cuguggauu cuuugugaaucaccau      gc a
    ||||  ||||||||| ||||||||||||||||      ||  
3'  cuuc  gauacuuaa gaaacauuugguggug      ug a
   a    gu         u                -----g  u 
Get sequence
Deep sequencing
952 reads, 0 reads per million, 9 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr15: 54985288-54985368 [+]
intergenic
Database links

Mature sequence mml-miR-876-5p

Accession MIMAT0006519
Sequence

11 - 

uggauuucuuugugaaucacca

 - 32

Get sequence
Deep sequencing753 reads, 8 experiments
Evidence by similarity; MI0005542
Database links
Predicted targets

Mature sequence mml-miR-876-3p

Accession MIMAT0006520
Sequence

50 - 

uggugguuuacaaaguaauuca

 - 71

Get sequence
Deep sequencing199 reads, 5 experiments
Evidence by similarity; MI0005542
Predicted targets

References

1