Stem-loop sequence mml-mir-876

Accession MI0007917
Description Macaca mulatta miR-876 stem-loop
Gene family MIPF0000430; mir-876
Stem-loop
u    ug         u                aucuaa  u 
 gaag  cuguggauu cuuugugaaucaccau      gc a
 ||||  ||||||||| ||||||||||||||||      ||  
 cuuc  gauacuuaa gaaacauuugguggug      ug a
a    gu         u                -----g  u 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MMUL1.0) Overlapping transcripts
15: 48249136-48249216 [+]
intergenic
Database links

Mature sequence mml-miR-876-5p

Accession MIMAT0006519
Sequence

11 - 

uggauuucuuugugaaucacca

 - 32

Get sequence
Evidence by similarity; MI0005542
Predicted targets

Mature sequence mml-miR-876-3p

Accession MIMAT0006520
Sequence

50 - 

uggugguuuacaaaguaauuca

 - 71

Get sequence
Evidence by similarity; MI0005542
Predicted targets

References

1