Stem-loop sequence mml-mir-875

Accession MI0007916
Description Macaca mulatta miR-875 stem-loop
Gene family MIPF0000424; mir-875
Stem-loop
--      gu  uau        u  a       uucc 
  uuagug  ac   accucagu uu ucaggug    u
  ||||||  ||   |||||||| || |||||||     
  agucac  ug   uggaguca aa gguccac    a
ca      uc  ugu        u  a       uaaa 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MMUL1.0) Overlapping transcripts
8: 102057977-102058052 [-]
sense
antisense
ENSMMUT00000031207 ; VPS13B-201; intron 30
ENSMMUT00000031206 ; VPS13B-204; intron 30
ENSMMUT00000031205 ; VPS13B-203; intron 31
Clustered miRNAs
< 10kb from mml-mir-875
mml-mir-875 8: 102057977-102058052 [-]
mml-mir-599 8: 102057827-102057921 [-]
Database links

Mature sequence mml-miR-875-5p

Accession MIMAT0006517
Sequence

11 - 

uauaccucaguuuuaucaggug

 - 32

Get sequence
Evidence by similarity; MI0005541
Predicted targets

Mature sequence mml-miR-875-3p

Accession MIMAT0006518
Sequence

45 - 

ccuggaaauacugagguugug

 - 65

Get sequence
Evidence by similarity; MI0005541
Predicted targets

References

1