Stem-loop sequence mml-mir-874

AccessionMI0007915 (change log)
DescriptionMacaca mulatta miR-874 stem-loop
Gene family MIPF0000401; mir-874
Literature search

1 open access papers mention mml-mir-874
(2 sentences)

Stem-loop
   --      cug   c   a  ca        a   -a a 
5'   uuagcc   cgg ccc cg  ccagggua gag  g g
     ||||||   ||| ||| ||  |||||||| |||  | u
3'   ggucgg   gcc ggg gc  ggucccgu cuu  c c
   cg      uca   a   a  cc        c   cg u 
Get sequence
Deep sequencing
13433 reads, 33.3 reads per million, 9 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr6: 135351570-135351647 [-]
sense
ENSMMUT00000002744 ; SIL1-201; intron 1
ENSMMUT00000041035 ; SIL1-202; intron 2
Database links

Mature sequence mml-miR-874-5p

Accession MIMAT0026910
Sequence

10 - 

cggccccacgcaccaggguaaga

 - 32

Get sequence
Deep sequencing394 reads, 9 experiments
Evidence experimental; Illumina [2]
Predicted targets

Mature sequence mml-miR-874-3p

Accession MIMAT0006516
Sequence

47 - 

cugcccuggcccgagggaccga

 - 68

Get sequence
Deep sequencing13038 reads, 9 experiments
Evidence experimental; Illumina [2]
Database links
Predicted targets

References

1
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).