Stem-loop sequence mml-mir-874

Accession MI0007915
Description Macaca mulatta miR-874 stem-loop
Gene family MIPF0000401; mir-874
Stem-loop
--      cug   c   a  ca        a   -a a 
  uuagcc   cgg ccc cg  ccagggua gag  g g
  ||||||   ||| ||| ||  |||||||| |||  | u
  ggucgg   gcc ggg gc  ggucccgu cuu  c c
cg      uca   a   a  cc        c   cg u 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MMUL1.0) Overlapping transcripts
6: 134048569-134048646 [-]
sense
ENSMMUT00000016705 ; KLHL3-201; intron 8
Database links

Mature sequence mml-miR-874-5p

Accession MIMAT0026910
Sequence

10 - 

cggccccacgcaccaggguaaga

 - 32

Get sequence
Evidence experimental; Solexa [23034410]

Mature sequence mml-miR-874-3p

Accession MIMAT0006516
Sequence

47 - 

cugcccuggcccgagggaccga

 - 68

Get sequence
Evidence experimental; Solexa [23034410]
Predicted targets

References

1
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).