Stem-loop sequence mml-mir-802

AccessionMI0007914 (change log)
DescriptionMacaca mulatta miR-802 stem-loop
Gene family MIPF0000353; mir-802
Stem-loop
   ---guu      u     auc   a          a      -   cc 
5'       cuguua uugca   agu acaaagauuc uccuug ugu  a
         |||||| |||||   ||| |||||||||| |||||| |||  u
3'       gauaau aaugu   uca uguuucuaag aggaac acg  c
   cagguc      u     gau   c          -      g   ua 
Get sequence
Deep sequencing
14 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr3: 10995704-10995797 [-]
intergenic
Database links

Mature sequence mml-miR-802

Accession MIMAT0006515
Sequence

18 - 

caguaacaaagauucauccuugu

 - 40

Get sequence
Deep sequencing11 reads, 2 experiments
Evidence by similarity; MI0003906
Predicted targets

References

1