![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence mml-mir-802 |
|||||
Accession | MI0007914 (change log) | ||||
Description | Macaca mulatta miR-802 stem-loop | ||||
Gene family | MIPF0000353; mir-802 | ||||
Stem-loop |
---guu u auc a a - cc 5' cuguua uugca agu acaaagauuc uccuug ugu a |||||| ||||| ||| |||||||||| |||||| ||| u 3' gauaau aaugu uca uguuucuaag aggaac acg c cagguc u gau c - g ua |
||||
Deep sequencing |
| ||||
Confidence |
Annotation confidence: not enough data
| ||||
Genome context |
|
||||
Database links |
Mature sequence mml-miR-802 |
|
Accession | MIMAT0006515 |
Sequence |
18 - caguaacaaagauucauccuugu - 40 |
Deep sequencing | 11 reads, 2 experiments |
Evidence | by similarity; MI0003906 |
Predicted targets |
|
References |
|
1 |
PMID:18186931
"Identification of novel homologous microRNA genes in the rhesus macaque genome"
BMC Genomics. 9:8(2008).
|