Stem-loop sequence mml-mir-802

AccessionMI0007914
DescriptionMacaca mulatta miR-802 stem-loop
Gene family MIPF0000353; mir-802
Stem-loop
---guu      u     auc   a          a      -   cc 
      cuguua uugca   agu acaaagauuc uccuug ugu  a
      |||||| |||||   ||| |||||||||| |||||| |||  u
      gauaau aaugu   uca uguuucuaag aggaac acg  c
cagguc      u     gau   c          -      g   ua 
Get sequence
Deep sequencing
9 reads, 0.483 reads per million, 4 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CR_1.0) Overlapping transcripts
chr3: 10976513-10976606 [-]
intergenic
Database links

Mature sequence mml-miR-802

Accession MIMAT0006515
Sequence

18 - 

caguaacaaagauucauccuugu

 - 40

Get sequence
Evidence by similarity; MI0003906
Predicted targets

References

1