Stem-loop sequence mml-mir-802

Accession MI0007914
Description Macaca mulatta miR-802 stem-loop
Gene family MIPF0000353; mir-802
Stem-loop
---guu      u     auc   a          a      -   cc 
      cuguua uugca   agu acaaagauuc uccuug ugu  a
      |||||| |||||   ||| |||||||||| |||||| |||  u
      gauaau aaugu   uca uguuucuaag aggaac acg  c
cagguc      u     gau   c          -      g   ua 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MMUL1.0) Overlapping transcripts
3: 10856064-10856157 [-]
intergenic
Database links

Mature sequence mml-miR-802

Accession MIMAT0006515
Sequence

18 - 

caguaacaaagauucauccuugu

 - 40

Get sequence
Evidence by similarity; MI0003906
Predicted targets

References

1