Stem-loop sequence mml-mir-770

Accession MI0007913
Description Macaca mulatta miR-770 stem-loop
Gene family MIPF0000355; mir-770
Stem-loop
         -c     cc   c              guca     a      cu 
5' aggagc  accuu  gag cuccaguaccacgu    gggcc caugag  g
   ||||||  |||||  ||| ||||||||||||||    ||||| ||||||   
3' uucucg  ugggg  cuc ggggucguggugua    uccgg gugcuc  g
         uc     -a   c              ---g     -      cg 
Get sequence
Deep sequencing
472 reads, 12.1 reads per million, 4 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CR_1.0) Overlapping transcripts
chr7: 164748744-164748841 [+]
intergenic
Database links

Mature sequence mml-miR-770-5p

Accession MIMAT0006514
Sequence

20 - 

uccaguaccacgugucagggcca

 - 42

Get sequence
Deep sequencing 1 reads, 1 experiments
Evidence by similarity; MI0005118
Predicted targets

References

1