Stem-loop sequence mml-mir-770

AccessionMI0007913
DescriptionMacaca mulatta miR-770 stem-loop
Gene family MIPF0000355; mir-770
Stem-loop
      -c     cc   c              guca     a      cu 
aggagc  accuu  gag cuccaguaccacgu    gggcc caugag  g
||||||  |||||  ||| ||||||||||||||    ||||| ||||||   
uucucg  ugggg  cuc ggggucguggugua    uccgg gugcuc  g
      uc     -a   c              ---g     -      cg 
Get sequence
Deep sequencing
472 reads, 12.1 reads per million, 4 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CR_1.0) Overlapping transcripts
chr7: 164748744-164748841 [+]
intergenic
Database links

Mature sequence mml-miR-770-5p

Accession MIMAT0006514
Sequence

20 - 

uccaguaccacgugucagggcca

 - 42

Get sequence
Deep sequencing1 reads, 1 experiments
Evidence by similarity; MI0005118
Predicted targets

References

1