Stem-loop sequence mml-mir-767

Accession MI0007911
Description Macaca mulatta miR-767 stem-loop
Gene family MIPF0000552; mir-767
Stem-loop
   -  -uuuu   u  u             u c       uu  c      u    c 
5'  gc     aua ug agguuuuugcuca g accaugg  gu ugagca gcag a
    ||     ||| || ||||||||||||| | |||||||  || |||||| |||| u
3'  cg     ugu ac ucuaaggacgagu u ugguacc  ca acucgu uguu g
   u  ucauc   u  u             c u       -c  u      c    c 
Get sequence
Deep sequencing
2247 reads, 33.2 reads per million, 8 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CR_1.0) Overlapping transcripts
chrX: 152014526-152014635 [-]
intergenic
Clustered miRNAs
< 10kb from mml-mir-767
mml-mir-767 chrX: 152014526-152014635 [-]
mml-mir-105-1 chrX: 152013334-152013414 [-]
Database links

Mature sequence mml-miR-767-5p

Accession MIMAT0006510
Sequence

27 - 

ugcaccaugguugucugagcaug

 - 49

Get sequence
Deep sequencing 1 reads, 1 experiments
Evidence by similarity; MI0003763
Predicted targets

Mature sequence mml-miR-767-3p

Accession MIMAT0006511
Sequence

61 - 

ucugcucauaccccaugguuucu

 - 83

Get sequence
Evidence by similarity; MI0003763
Predicted targets

References

1