Stem-loop sequence mml-mir-767

Accession MI0007911
Description Macaca mulatta miR-767 stem-loop
Gene family MIPF0000552; mir-767
Stem-loop
-  -uuuu   u  u             u c       uu  c      u    c 
 gc     aua ug agguuuuugcuca g accaugg  gu ugagca gcag a
 ||     ||| || ||||||||||||| | |||||||  || |||||| |||| u
 cg     ugu ac ucuaaggacgagu u ugguacc  ca acucgu uguu g
u  ucauc   u  u             c u       -c  u      c    c 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MMUL1.0) Overlapping transcripts
X: 150474738-150474847 [-]
sense
ENSMMUT00000002176 ; MMU.3820-201; intron 1
Clustered miRNAs
< 10kb from mml-mir-767
mml-mir-105-2 X: 150475738-150475818 [-]
mml-mir-767 X: 150474738-150474847 [-]
mml-mir-105-1 X: 150473546-150473626 [-]
Database links

Mature sequence mml-miR-767-5p

Accession MIMAT0006510
Sequence

27 - 

ugcaccaugguugucugagcaug

 - 49

Get sequence
Evidence by similarity; MI0003763
Predicted targets

Mature sequence mml-miR-767-3p

Accession MIMAT0006511
Sequence

61 - 

ucugcucauaccccaugguuucu

 - 83

Get sequence
Evidence by similarity; MI0003763
Predicted targets

References

1