Stem-loop sequence mml-mir-765

Accession MI0007910
Description Macaca mulatta miR-765 stem-loop
Gene family MIPF0000545; mir-765
Stem-loop
   uuuag     g    a  ug --ag       ga aa        -----        caa 
5'      gggcu auga ag  g    uucagua  c  cccuuuuc     aagcccug   g
        ||||| |||| ||  |    |||||||  |  ||||||||     ||||||||    
3'      uccga ugcu uc  c    aagucgu  g  gggagagg     uuuggggu   a
   --aag     g    c  gu gggg       -g aa        agguc        caa 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence mml-miR-765

Accession MIMAT0006509
Sequence

69 - 

uggaggagagggaaggugcug

 - 89

Get sequence
Evidence by similarity; MI0005116
Predicted targets

References

1