Stem-loop sequence mml-mir-675

AccessionMI0007908 (change log)
DescriptionMacaca mulatta miR-675 stem-loop
Gene family MIPF0000365; mir-675
Stem-loop
          u    u    a      cc      gacu 
5' cccaggg cugg gcgg gagggc  acagug    u
   ||||||| |||| |||| ||||||  ||||||     
3' ggguccc gacu cgcc cucccg  ugucac    g
          c    -    a      ua      agug 
Get sequence
Deep sequencing
249 reads, 0 reads per million, 8 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr14: 1833156-1833228 [-]
intergenic
Database links

Mature sequence mml-miR-675-5p

Accession MIMAT0006507
Sequence

10 - 

uggugcggagagggcccacagug

 - 32

Get sequence
Deep sequencing6 reads, 2 experiments
Evidence experimental; Illumina [2]
Predicted targets

Mature sequence mml-miR-675-3p

Accession MIMAT0026908
Sequence

45 - 

cuguaugcccucaccgcucagc

 - 66

Get sequence
Deep sequencing243 reads, 8 experiments
Evidence experimental; Illumina [2]
Predicted targets

References

1
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).