Stem-loop sequence mml-mir-675

Accession MI0007908
Description Macaca mulatta miR-675 stem-loop
Gene family MIPF0000365; mir-675
Stem-loop
       u    u    a      cc      gacu 
cccaggg cugg gcgg gagggc  acagug    u
||||||| |||| |||| ||||||  ||||||     
ggguccc gacu cgcc cucccg  ugucac    g
       c    -    a      ua      agug 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MMUL1.0) Overlapping transcripts
14: 1908081-1908153 [-]
intergenic
Database links

Mature sequence mml-miR-675-5p

Accession MIMAT0006507
Sequence

10 - 

uggugcggagagggcccacagug

 - 32

Get sequence
Evidence experimental; Solexa [23034410]
Predicted targets

Mature sequence mml-miR-675-3p

Accession MIMAT0026908
Sequence

45 - 

cuguaugcccucaccgcucagc

 - 66

Get sequence
Evidence experimental; Solexa [23034410]

References

1
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).