Stem-loop sequence mml-mir-671

Accession MI0007907
Description Macaca mulatta miR-671 stem-loop
Gene family MIPF0000358; mir-671
Stem-loop
   ggu aa     ----a    a        a   a      ga           -u   g 
gca   g  cuggc     ggcc ggaagagg gga gcccug  ggggcuggagg  gau g
|||   |  |||||     |||| |||||||| ||| ||||||  |||||||||||  |||  
cgu   c  gaccg     ccgg cuuucucc ccu cgggac  ucuuggccucc  uug a
   ggu gg     agaug    g        a   -      --           uu   u 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MMUL1.0) Overlapping transcripts
3: 188187719-188187836 [+]
sense
ENSMMUT00000009354 ; mml-mir-671-202; 3'UTR (exon 4)
ENSMMUT00000009361 ; mml-mir-671-203; intron 4
ENSMMUT00000009357 ; mml-mir-671-201; 3'UTR (exon 5)
Database links

Mature sequence mml-miR-671-5p

Accession MIMAT0006505
Sequence

29 - 

aggaagcccuggaggggcuggag

 - 51

Get sequence
Evidence by similarity; MI0003760
Predicted targets

Mature sequence mml-miR-671-3p

Accession MIMAT0006506
Sequence

68 - 

uccgguucucagggcuccacc

 - 88

Get sequence
Evidence by similarity; MI0003760
Predicted targets

References

1