Stem-loop sequence mml-mir-671

Accession MI0007907
Description Macaca mulatta miR-671 stem-loop
Gene family MIPF0000358; mir-671
Stem-loop
      ggu aa     ----a    a        a   a      ga           -u   g 
5' gca   g  cuggc     ggcc ggaagagg gga gcccug  ggggcuggagg  gau g
   |||   |  |||||     |||| |||||||| ||| ||||||  |||||||||||  |||  
3' cgu   c  gaccg     ccgg cuuucucc ccu cgggac  ucuuggccucc  uug a
      ggu gg     agaug    g        a   -      --           uu   u 
Get sequence
Deep sequencing
1796 reads, 41.8 reads per million, 8 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CR_1.0) Overlapping transcripts
chr3: 190188611-190188728 [+]
intergenic
Database links

Mature sequence mml-miR-671-5p

Accession MIMAT0006505
Sequence

29 - 

aggaagcccuggaggggcuggag

 - 51

Get sequence
Evidence by similarity; MI0003760
Predicted targets

Mature sequence mml-miR-671-3p

Accession MIMAT0006506
Sequence

68 - 

uccgguucucagggcuccacc

 - 88

Get sequence
Deep sequencing 5 reads, 2 experiments
Evidence by similarity; MI0003760
Predicted targets

References

1