Stem-loop sequence mml-mir-668

AccessionMI0007906 (change log)
DescriptionMacaca mulatta miR-668 stem-loop
Gene family MIPF0000357; mir-668
Stem-loop
       a   c   ---        g         a 
5' ggua gug gcc   ucggguga caugcacuu a
   |||| ||| |||   |||||||| ||||||||| u
3' ccau cac cgg   ggcucacu guauguggg g
       -   c   cuc        -         u 
Get sequence
Deep sequencing
725 reads, 0 reads per million, 6 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr7: 163389270-163389335 [+]
intergenic
Clustered miRNAs
< 10kb from mml-mir-668
mml-mir-381chr7: 163379925-163379999 [+]
mml-mir-487bchr7: 163380460-163380543 [+]
mml-mir-539chr7: 163381316-163381393 [+]
mml-mir-889chr7: 163381893-163381971 [+]
mml-mir-544chr7: 163382652-163382742 [+]
mml-mir-487achr7: 163386465-163386544 [+]
mml-mir-382chr7: 163388320-163388395 [+]
mml-mir-134chr7: 163388701-163388773 [+]
mml-mir-668chr7: 163389270-163389335 [+]
mml-mir-485chr7: 163389434-163389506 [+]
mml-mir-323bchr7: 163390241-163390297 [+]
mml-mir-154chr7: 163393750-163393833 [+]
mml-mir-496chr7: 163394601-163394702 [+]
mml-mir-377chr7: 163395850-163395918 [+]
mml-mir-541chr7: 163398288-163398371 [+]
mml-mir-409chr7: 163399096-163399174 [+]
mml-mir-412chr7: 163399243-163399333 [+]
Database links

Mature sequence mml-miR-668

Accession MIMAT0006504
Sequence

43 - 

ugucacucggcucggcccacuac

 - 65

Get sequence
Deep sequencing718 reads, 6 experiments
Evidence by similarity; MI0003761
Predicted targets

References

1