Stem-loop sequence mml-mir-668

Accession MI0007906
Description Macaca mulatta miR-668 stem-loop
Gene family MIPF0000357; mir-668
Stem-loop
       a   c   ---        g         a 
5' ggua gug gcc   ucggguga caugcacuu a
   |||| ||| |||   |||||||| ||||||||| u
3' ccau cac cgg   ggcucacu guauguggg g
       -   c   cuc        -         u 
Get sequence
Deep sequencing
236 reads, 4.76 reads per million, 5 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CR_1.0) Overlapping transcripts
chr7: 164953688-164953753 [+]
intergenic
Clustered miRNAs
< 10kb from mml-mir-668
mml-mir-381 chr7: 164944340-164944414 [+]
mml-mir-487b chr7: 164944875-164944958 [+]
mml-mir-539 chr7: 164945731-164945808 [+]
mml-mir-889 chr7: 164946308-164946386 [+]
mml-mir-544 chr7: 164947069-164947159 [+]
mml-mir-487a chr7: 164950883-164950962 [+]
mml-mir-382 chr7: 164952738-164952813 [+]
mml-mir-134 chr7: 164953119-164953191 [+]
mml-mir-668 chr7: 164953688-164953753 [+]
mml-mir-485 chr7: 164953852-164953924 [+]
mml-mir-323b chr7: 164954659-164954715 [+]
mml-mir-154 chr7: 164958168-164958251 [+]
mml-mir-496 chr7: 164959019-164959120 [+]
mml-mir-377 chr7: 164960414-164960482 [+]
mml-mir-541 chr7: 164962858-164962941 [+]
mml-mir-409 chr7: 164963666-164963744 [+]
Database links

Mature sequence mml-miR-668

Accession MIMAT0006504
Sequence

43 - 

ugucacucggcucggcccacuac

 - 65

Get sequence
Deep sequencing 3 reads, 2 experiments
Evidence by similarity; MI0003761
Predicted targets

References

1