Stem-loop sequence mml-mir-668

Accession MI0007906
Description Macaca mulatta miR-668 stem-loop
Gene family MIPF0000357; mir-668
Stem-loop
    a   c   ---        g         a 
ggua gug gcc   ucggguga caugcacuu a
|||| ||| |||   |||||||| ||||||||| u
ccau cac cgg   ggcucacu guauguggg g
    -   c   cuc        -         u 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MMUL1.0) Overlapping transcripts
7: 164339183-164339248 [+]
intergenic
Clustered miRNAs
< 10kb from mml-mir-668
mml-mir-381 7: 164330417-164330491 [+]
mml-mir-487b 7: 164330952-164331035 [+]
mml-mir-539 7: 164331808-164331885 [+]
mml-mir-889 7: 164332385-164332463 [+]
mml-mir-544 7: 164333144-164333234 [+]
mml-mir-487a 7: 164336378-164336457 [+]
mml-mir-382 7: 164338233-164338308 [+]
mml-mir-134 7: 164338614-164338686 [+]
mml-mir-668 7: 164339183-164339248 [+]
mml-mir-485 7: 164339347-164339419 [+]
mml-mir-323b 7: 164340154-164340210 [+]
mml-mir-154 7: 164343663-164343746 [+]
mml-mir-496 7: 164344514-164344615 [+]
mml-mir-377 7: 164345705-164345773 [+]
mml-mir-541 7: 164348143-164348226 [+]
mml-mir-409 7: 164348951-164349029 [+]
mml-mir-412 7: 164349098-164349188 [+]
Database links

Mature sequence mml-miR-668

Accession MIMAT0006504
Sequence

43 - 

ugucacucggcucggcccacuac

 - 65

Get sequence
Evidence by similarity; MI0003761
Predicted targets

References

1