Stem-loop sequence mml-mir-664

Accession MI0007905
Description Macaca mulatta miR-664 stem-loop
Gene family MIPF0000300; mir-664
Stem-loop
cu    a    aaa   u         aa 
  ggcu ggga   uga uggauagaa  u
  |||| ||||   ||| |||||||||  g
  ccga cccu   auu acuuaucuu  u
au    c    ---   u         au 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MMUL1.0) Overlapping transcripts
1: 150162125-150162182 [+]
sense
ENSMMUT00000050355 ; SNORA36-201; exon 1
ENSMMUT00000010901 ; MMU.12194-202; intron 7
ENSMMUT00000045297 ; MMU.12194-201; intron 9
ENSMMUT00000010907 ; MMU.12194-203; intron 9
Database links

Mature sequence mml-miR-664

Accession MIMAT0006503
Sequence

38 - 

uauucauuuauccccagccua

 - 58

Get sequence
Evidence by similarity; MI0006442
Predicted targets

References

1