Stem-loop sequence mml-mir-664

AccessionMI0007905
DescriptionMacaca mulatta miR-664 stem-loop
Gene family MIPF0000300; mir-664
Stem-loop
cu    a    aaa   u         aa 
  ggcu ggga   uga uggauagaa  u
  |||| ||||   ||| |||||||||  g
  ccga cccu   auu acuuaucuu  u
au    c    ---   u         au 
Get sequence
Deep sequencing
2524 reads, 37.9 reads per million, 8 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CR_1.0) Overlapping transcripts
chr1: 150705062-150705119 [+]
intergenic
Database links

Mature sequence mml-miR-664

Accession MIMAT0006503
Sequence

38 - 

uauucauuuauccccagccua

 - 58

Get sequence
Deep sequencing7 reads, 3 experiments
Evidence by similarity; MI0006442
Predicted targets

References

1