|
miRBase |
|
Stem-loop sequence mml-mir-664 |
|||||
| Accession | MI0007905 | ||||
| Description | Macaca mulatta miR-664 stem-loop | ||||
| Gene family | MIPF0000300; mir-664 | ||||
| Stem-loop |
cu a aaa u aa ggcu ggga uga uggauagaa u |||| |||| ||| ||||||||| g ccga cccu auu acuuaucuu u au c --- u au |
||||
| Genome context |
|
||||
| Database links |
|
||||
Mature sequence mml-miR-664 |
|
| Accession | MIMAT0006503 |
| Sequence |
38 - uauucauuuauccccagccua - 58 |
| Evidence | by similarity; MI0006442 |
| Predicted targets |
|
References |
|
| 1 |
PMID:18186931
"Identification of novel homologous microRNA genes in the rhesus macaque genome"
BMC Genomics. 9:8(2008).
|