Stem-loop sequence mml-mir-664

AccessionMI0007905 (change log)
DescriptionMacaca mulatta miR-664 stem-loop
Gene family MIPF0000300; mir-664
Stem-loop
   cu    a    aaa   u         aa 
5'   ggcu ggga   uga uggauagaa  u
     |||| ||||   ||| |||||||||  g
3'   ccga cccu   auu acuuaucuu  u
   au    c    ---   u         au 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr1: 146157567-146157624 [+]
intergenic
Database links

Mature sequence mml-miR-664

Accession MIMAT0006503
Sequence

38 - 

uauucauuuauccccagccua

 - 58

Get sequence
Evidence by similarity; MI0006442
Predicted targets

References

1