Stem-loop sequence mml-mir-663-1

Accession MI0007904
Previous IDs mml-mir-663
Description Macaca mulatta miR-663-1 stem-loop
Gene family MIPF0000462; mir-663
Stem-loop
   cc uu   c   -     -c  g   - ug     --     c   ug 
5'   g  cgg guc ccagg  gg gcg c  cggga  ccgcc ucg  u
     |  ||| ||| |||||  || ||| |  |||||  ||||| |||   
3'   c  gcc cgg ggucc  uu ugc g  gcccu  ggugg ggu  c
   -- cg   -   u     uu  g   c gu     ag     c   gu 
Get sequence
Deep sequencing
2 reads, 0.328 reads per million, 1 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CR_1.0) Overlapping transcripts
JH305640.1: 89-178 [+]
intergenic
Database links

Mature sequence mml-miR-663

Accession MIMAT0006502
Sequence

15 - 

aggcggggcgcugcgggaccgc

 - 36

Get sequence
Evidence by similarity; MI0003672
Predicted targets

References

1