Stem-loop sequence mml-mir-662

AccessionMI0007903 (change log)
DescriptionMacaca mulatta miR-662 stem-loop
Gene family MIPF0000492; mir-662
Stem-loop
   -------------       a    gu     ---ca       a   u     gg u 
5'              gcuguug ggcu  acagc     ggaccug cgg ggggu  c u
                ||||||| ||||  |||||     ||||||| ||| |||||  |  
3'              cgacgac ccgg  uguug     ucuggac guc uuccg  g c
   cguugcacugacg       -    --     caccc       -   -     -- g 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr20: 758887-758981 [+]
intergenic
Database links

Mature sequence mml-miR-662

Accession MIMAT0006501
Sequence

61 - 

ucccacguuguggcccagcag

 - 81

Get sequence
Evidence by similarity; MI0003670
Predicted targets

References

1