Stem-loop sequence mml-mir-662

Accession MI0007903
Description Macaca mulatta miR-662 stem-loop
Gene family MIPF0000492; mir-662
Stem-loop
-------------       a    gu     ---ca       a   u     gg u 
             gcuguug ggcu  acagc     ggaccug cgg ggggu  c u
             ||||||| ||||  |||||     ||||||| ||| |||||  |  
             cgacgac ccgg  uguug     ucuggac guc uuccg  g c
cguugcacugacg       -    --     caccc       -   -     -- g 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MMUL1.0) Overlapping transcripts
20: 765005-765099 [+]
antisense
ENSMMUT00000037008 ; mml-mir-662-202; exon 11
ENSMMUT00000001207 ; mml-mir-662-201; exon 18
Database links

Mature sequence mml-miR-662

Accession MIMAT0006501
Sequence

61 - 

ucccacguuguggcccagcag

 - 81

Get sequence
Evidence by similarity; MI0003670
Predicted targets

References

1