Stem-loop sequence mml-mir-661

AccessionMI0007902 (change log)
DescriptionMacaca mulatta miR-661 stem-loop
Gene family MIPF0000465; mir-661
Stem-loop
   ggaga      g  gu    -  g    u    u     g  -u -     ug 
5'      ggcugu cu  gggg ca gcgc ggcc gggug cc  g agccc  a
        |||||| ||  |||| || |||| |||| ||||| ||  | |||||  u
3'      ucggcg gg  uucc gu cgug ccgg ucuau gg  c ucggg  u
   -----      g  --    a  g    c    -     g  uc g     uu 
Get sequence
Deep sequencing
9 reads, 0 reads per million, 6 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr8: 143206016-143206113 [-]
intergenic
Database links

Mature sequence mml-miR-661

Accession MIMAT0006500
Sequence

60 - 

ugccuggguaucuggcccgugcgu

 - 83

Get sequence
Evidence by similarity; MI0003669
Predicted targets

References

1