Stem-loop sequence mml-mir-660

Accession MI0007901
Description Macaca mulatta miR-660 stem-loop
Gene family MIPF0000113; mir-188
Stem-loop
   ----------cu    c      -cauac    u      c    u   aaau 
5'             gcuc uucucc      ccau gcauau ggag ugu    u
               |||| ||||||      |||| |||||| |||| |||    c
3'             cgag gggagg      ggua cgugug ccuc aca    u
   gugcuacuguuc    u      acauua    -      u    c   aaac 
Get sequence
Deep sequencing
3621 reads, 131 reads per million, 8 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CR_1.0) Overlapping transcripts
JH290886.1: 45211-45307 [+]
intergenic
Clustered miRNAs
< 10kb from mml-mir-660
mml-mir-500a JH290886.1: 38665-38748 [+]
mml-mir-362 JH290886.1: 39196-39260 [+]
mml-mir-501 JH290886.1: 39956-40039 [+]
mml-mir-500b JH290886.1: 42676-42736 [+]
mml-mir-660 JH290886.1: 45211-45307 [+]
mml-mir-502 JH290886.1: 46570-46649 [+]
Database links

Mature sequence mml-miR-660-5p

Accession MIMAT0006499
Sequence

16 - 

uacccauugcauaucggaguug

 - 37

Get sequence
Deep sequencing 35 reads, 7 experiments
Evidence experimental; Illumina [2]
Predicted targets

Mature sequence mml-miR-660-3p

Accession MIMAT0026907
Sequence

52 - 

accuccugugugcauggauuac

 - 73

Get sequence
Evidence experimental; Illumina [2]

References

1
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).