Stem-loop sequence mml-mir-660

AccessionMI0007901 (change log)
DescriptionMacaca mulatta miR-660 stem-loop
Gene family MIPF0000113; mir-188
Stem-loop
   ----------cu    c      -cauac    u      c    u   aaau 
5'             gcuc uucucc      ccau gcauau ggag ugu    u
               |||| ||||||      |||| |||||| |||| |||    c
3'             cgag gggagg      ggua cgugug ccuc aca    u
   gugcuacuguuc    u      acauua    -      u    c   aaac 
Get sequence
Deep sequencing
5503 reads, 22.2 reads per million, 9 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chrX: 50020567-50020663 [+]
intergenic
Clustered miRNAs
< 10kb from mml-mir-660
mml-mir-500achrX: 50013494-50013577 [+]
mml-mir-362chrX: 50014025-50014089 [+]
mml-mir-501chrX: 50014785-50014868 [+]
mml-mir-500bchrX: 50017286-50017346 [+]
mml-mir-660chrX: 50020567-50020663 [+]
mml-mir-502chrX: 50021926-50022005 [+]
Database links

Mature sequence mml-miR-660-5p

Accession MIMAT0006499
Sequence

16 - 

uacccauugcauaucggaguug

 - 37

Get sequence
Deep sequencing5472 reads, 9 experiments
Evidence experimental; Illumina [2]
Database links
Predicted targets

Mature sequence mml-miR-660-3p

Accession MIMAT0026907
Sequence

52 - 

accuccugugugcauggauuac

 - 73

Get sequence
Deep sequencing29 reads, 9 experiments
Evidence experimental; Illumina [2]
Predicted targets

References

1
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).