Stem-loop sequence mml-mir-660

Accession MI0007901
Description Macaca mulatta miR-660 stem-loop
Gene family MIPF0000113; mir-188
Stem-loop
----------cu    c      -cauac    u      c    u   aaau 
            gcuc uucucc      ccau gcauau ggag ugu    u
            |||| ||||||      |||| |||||| |||| |||    c
            cgag gggagg      ggua cgugug ccuc aca    u
gugcuacuguuc    u      acauua    -      u    c   aaac 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MMUL1.0) Overlapping transcripts
X: 47649746-47649842 [+]
sense
ENSMMUT00000032444 ; CLCN5-201; intron 3
Clustered miRNAs
< 10kb from mml-mir-660
mml-mir-500a X: 47643501-47643584 [+]
mml-mir-362 X: 47644032-47644096 [+]
mml-mir-501 X: 47644792-47644875 [+]
mml-mir-500b X: 47647191-47647251 [+]
mml-mir-660 X: 47649746-47649842 [+]
mml-mir-502 X: 47651105-47651184 [+]
Database links

Mature sequence mml-miR-660-5p

Accession MIMAT0006499
Sequence

16 - 

uacccauugcauaucggaguug

 - 37

Get sequence
Evidence experimental; Solexa [23034410]
Predicted targets

Mature sequence mml-miR-660-3p

Accession MIMAT0026907
Sequence

52 - 

accuccugugugcauggauuac

 - 73

Get sequence
Evidence experimental; Solexa [23034410]

References

1
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).