|
miRBase |
|
Stem-loop sequence mml-mir-657 |
||||||||
| Accession | MI0007900 | |||||||
| Description | Macaca mulatta miR-657 stem-loop | |||||||
| Gene family | MIPF0000498; mir-657 | |||||||
| Stem-loop |
g ga u a c ac -- u gagga ggg ccuggaga g gugg ggcu ccagg g ||||| ||| |||||||| | |||| |||| ||||| g cucuu ccc ggaucucu c cacu cugg ggucu g - ac - c - -c ac u |
|||||||
| Genome context |
|
|||||||
| Clustered miRNAs |
|
|||||||
| Database links |
|
|||||||
Mature sequence mml-miR-657 |
|
| Accession | MIMAT0006498 |
| Sequence |
47 - ggcagguccucacccucucuagg - 69 |
| Evidence | by similarity; MI0003681 |
References |
|
| 1 |
PMID:18186931
"Identification of novel homologous microRNA genes in the rhesus macaque genome"
BMC Genomics. 9:8(2008).
|