Stem-loop sequence mml-mir-657

AccessionMI0007900 (change log)
DescriptionMacaca mulatta miR-657 stem-loop
Gene family MIPF0000498; mir-657
Stem-loop
   g     ga   u        a c    ac    --     u 
5'  gagga  ggg ccuggaga g gugg  ggcu  ccagg g
    |||||  ||| |||||||| | ||||  ||||  ||||| g
3'  cucuu  ccc ggaucucu c cacu  cugg  ggucu g
   -     ac   -        c -    -c    ac     u 
Get sequence
Deep sequencing
3 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr16: 74986304-74986382 [-]
intergenic
Clustered miRNAs
< 10kb from mml-mir-657
mml-mir-1250chr16: 74994245-74994354 [-]
mml-mir-338chr16: 74986911-74986977 [-]
mml-mir-657chr16: 74986304-74986382 [-]
Database links

Mature sequence mml-miR-657

Accession MIMAT0006498
Sequence

47 - 

ggcagguccucacccucucuagg

 - 69

Get sequence
Evidence by similarity; MI0003681
Predicted targets

References

1