Stem-loop sequence mml-mir-657

Accession MI0007900
Description Macaca mulatta miR-657 stem-loop
Gene family MIPF0000498; mir-657
Stem-loop
g     ga   u        a c    ac    --     u 
 gagga  ggg ccuggaga g gugg  ggcu  ccagg g
 |||||  ||| |||||||| | ||||  ||||  ||||| g
 cucuu  ccc ggaucucu c cacu  cugg  ggucu g
-     ac   -        c -    -c    ac     u 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MMUL1.0) Overlapping transcripts
16: 76575276-76575354 [-]
sense
ENSMMUT00000040902 ; AATK-201; intron 5
ENSMMUT00000040904 ; AATK-203; intron 6
ENSMMUT00000021761 ; AATK-202; intron 6
Clustered miRNAs
< 10kb from mml-mir-657
mml-mir-1250 16: 76583140-76583249 [-]
mml-mir-338 16: 76575883-76575949 [-]
mml-mir-657 16: 76575276-76575354 [-]
Database links

Mature sequence mml-miR-657

Accession MIMAT0006498
Sequence

47 - 

ggcagguccucacccucucuagg

 - 69

Get sequence
Evidence by similarity; MI0003681
Predicted targets

References

1