Stem-loop sequence mml-mir-657

Accession MI0007900
Description Macaca mulatta miR-657 stem-loop
Gene family MIPF0000498; mir-657
Stem-loop
   g     ga   u        a c    ac    --     u 
5'  gagga  ggg ccuggaga g gugg  ggcu  ccagg g
    |||||  ||| |||||||| | ||||  ||||  ||||| g
3'  cucuu  ccc ggaucucu c cacu  cugg  ggucu g
   -     ac   -        c -    -c    ac     u 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence mml-miR-657

Accession MIMAT0006498
Sequence

47 - 

ggcagguccucacccucucuagg

 - 69

Get sequence
Evidence by similarity; MI0003681
Predicted targets

References

1