Stem-loop sequence mml-mir-656

AccessionMI0007899 (change log)
DescriptionMacaca mulatta miR-656 stem-loop
Gene family MIPF0000018; mir-154
Stem-loop
   ----------cu    u      u     ag       cuu  u 
5'             gaaa agguug cugug  guguuca   uc a
               |||| |||||| |||||  |||||||   || u
3'             cuuu uccaac gacau  uauaagu   ag a
   cuaagcuauagc    c      u     au       ---  u 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr7: 163400519-163400596 [+]
intergenic
Clustered miRNAs
< 10kb from mml-mir-656
mml-mir-154chr7: 163393750-163393833 [+]
mml-mir-496chr7: 163394601-163394702 [+]
mml-mir-377chr7: 163395850-163395918 [+]
mml-mir-541chr7: 163398288-163398371 [+]
mml-mir-409chr7: 163399096-163399174 [+]
mml-mir-412chr7: 163399243-163399333 [+]
mml-mir-369chr7: 163399393-163399462 [+]
mml-mir-410chr7: 163399706-163399785 [+]
mml-mir-656chr7: 163400519-163400596 [+]
Database links

Mature sequence mml-miR-656-5p

Accession MIMAT0026906
Sequence

8 - 

agguugucugugagguguuca

 - 28

Get sequence
Evidence experimental; Illumina [2]
Predicted targets

Mature sequence mml-miR-656-3p

Accession MIMAT0006497
Sequence

43 - 

aauauuauacagucaaccucu

 - 63

Get sequence
Evidence experimental; Illumina [2]
Predicted targets

References

1
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).