Stem-loop sequence mml-mir-656

AccessionMI0007899
DescriptionMacaca mulatta miR-656 stem-loop
Gene family MIPF0000018; mir-154
Stem-loop
----------cu    u      u     ag       cuu  u 
            gaaa agguug cugug  guguuca   uc a
            |||| |||||| |||||  |||||||   || u
            cuuu uccaac gacau  uauaagu   ag a
cuaagcuauagc    c      u     au       ---  u 
Get sequence
Deep sequencing
506 reads, 7.54 reads per million, 8 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CR_1.0) Overlapping transcripts
chr7: 164965089-164965166 [+]
intergenic
Clustered miRNAs
< 10kb from mml-mir-656
mml-mir-154chr7: 164958168-164958251 [+]
mml-mir-496chr7: 164959019-164959120 [+]
mml-mir-377chr7: 164960414-164960482 [+]
mml-mir-541chr7: 164962858-164962941 [+]
mml-mir-409chr7: 164963666-164963744 [+]
mml-mir-412chr7: 164963813-164963903 [+]
mml-mir-369chr7: 164963963-164964032 [+]
mml-mir-410chr7: 164964276-164964355 [+]
mml-mir-656chr7: 164965089-164965166 [+]
Database links

Mature sequence mml-miR-656-5p

Accession MIMAT0026906
Sequence

8 - 

agguugucugugagguguuca

 - 28

Get sequence
Evidence experimental; Illumina [2]

Mature sequence mml-miR-656-3p

Accession MIMAT0006497
Sequence

43 - 

aauauuauacagucaaccucu

 - 63

Get sequence
Deep sequencing10 reads, 4 experiments
Evidence experimental; Illumina [2]
Predicted targets

References

1
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).