Stem-loop sequence mml-mir-656

Accession MI0007899
Description Macaca mulatta miR-656 stem-loop
Gene family MIPF0000018; mir-154
Stem-loop
----------cu    u      u     ag       cuu  u 
            gaaa agguug cugug  guguuca   uc a
            |||| |||||| |||||  |||||||   || u
            cuuu uccaac gacau  uauaagu   ag a
cuaagcuauagc    c      u     au       ---  u 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MMUL1.0) Overlapping transcripts
7: 164350374-164350451 [+]
intergenic
Clustered miRNAs
< 10kb from mml-mir-656
mml-mir-154 7: 164343663-164343746 [+]
mml-mir-496 7: 164344514-164344615 [+]
mml-mir-377 7: 164345705-164345773 [+]
mml-mir-541 7: 164348143-164348226 [+]
mml-mir-409 7: 164348951-164349029 [+]
mml-mir-412 7: 164349098-164349188 [+]
mml-mir-369 7: 164349248-164349317 [+]
mml-mir-410 7: 164349561-164349640 [+]
mml-mir-656 7: 164350374-164350451 [+]
Database links

Mature sequence mml-miR-656-5p

Accession MIMAT0026906
Sequence

8 - 

agguugucugugagguguuca

 - 28

Get sequence
Evidence experimental; Solexa [23034410]

Mature sequence mml-miR-656-3p

Accession MIMAT0006497
Sequence

43 - 

aauauuauacagucaaccucu

 - 63

Get sequence
Evidence experimental; Solexa [23034410]
Predicted targets

References

1
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).