Stem-loop sequence mml-mir-654

AccessionMI0007898 (change log)
DescriptionMacaca mulatta miR-654 stem-loop
Gene family MIPF0000409; mir-654
Stem-loop
       aagugg    a      g c     a      - -  a 
5' gggu      aaag uggugg c gcaga caugug c ug g
   ||||      |||| |||||| | ||||| |||||| | ||  
3' cccg      uuuc acuacc g cgucu guauac g gc u
       --aaga    c      a u     -      c u  u 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr7: 163374225-163374305 [+]
intergenic
Clustered miRNAs
< 10kb from mml-mir-654
mml-mir-543chr7: 163366417-163366496 [+]
mml-mir-495chr7: 163368266-163368347 [+]
mml-mir-376cchr7: 163373697-163373762 [+]
mml-mir-376a-2chr7: 163374075-163374154 [+]
mml-mir-654chr7: 163374225-163374305 [+]
mml-mir-376bchr7: 163374442-163374541 [+]
mml-mir-376a-1chr7: 163374788-163374855 [+]
mml-mir-1185-2chr7: 163376994-163377052 [+]
mml-mir-1185-1chr7: 163378194-163378303 [+]
mml-mir-381chr7: 163379925-163379999 [+]
mml-mir-487bchr7: 163380460-163380543 [+]
mml-mir-539chr7: 163381316-163381393 [+]
mml-mir-889chr7: 163381893-163381971 [+]
mml-mir-544chr7: 163382652-163382742 [+]
Database links

Mature sequence mml-miR-654-5p

Accession MIMAT0006495
Sequence

16 - 

uggugggccgcagaacaugugc

 - 37

Get sequence
Evidence by similarity; MI0003676
Predicted targets

Mature sequence mml-miR-654-3p

Accession MIMAT0006496
Sequence

51 - 

uaugucugcugaccaucaccuu

 - 72

Get sequence
Evidence by similarity; MI0003676
Database links
Predicted targets

References

1