Stem-loop sequence mml-mir-654

Accession MI0007898
Description Macaca mulatta miR-654 stem-loop
Gene family MIPF0000409; mir-654
Stem-loop
       aagugg    a      g c     a      - -  a 
5' gggu      aaag uggugg c gcaga caugug c ug g
   ||||      |||| |||||| | ||||| |||||| | ||  
3' cccg      uuuc acuacc g cgucu guauac g gc u
       --aaga    c      a u     -      c u  u 
Get sequence
Deep sequencing
2572 reads, 39.8 reads per million, 8 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CR_1.0) Overlapping transcripts
chr7: 164938642-164938722 [+]
intergenic
Clustered miRNAs
< 10kb from mml-mir-654
mml-mir-543 chr7: 164930881-164930960 [+]
mml-mir-495 chr7: 164932634-164932715 [+]
mml-mir-376c chr7: 164938114-164938179 [+]
mml-mir-376a-2 chr7: 164938492-164938571 [+]
mml-mir-654 chr7: 164938642-164938722 [+]
mml-mir-376b chr7: 164938859-164938958 [+]
mml-mir-376a-1 chr7: 164939205-164939272 [+]
mml-mir-1185-2 chr7: 164941410-164941468 [+]
mml-mir-1185-1 chr7: 164942609-164942718 [+]
mml-mir-381 chr7: 164944340-164944414 [+]
mml-mir-487b chr7: 164944875-164944958 [+]
mml-mir-539 chr7: 164945731-164945808 [+]
mml-mir-889 chr7: 164946308-164946386 [+]
mml-mir-544 chr7: 164947069-164947159 [+]
Database links

Mature sequence mml-miR-654-5p

Accession MIMAT0006495
Sequence

16 - 

uggugggccgcagaacaugugc

 - 37

Get sequence
Deep sequencing 3 reads, 2 experiments
Evidence by similarity; MI0003676
Predicted targets

Mature sequence mml-miR-654-3p

Accession MIMAT0006496
Sequence

51 - 

uaugucugcugaccaucaccuu

 - 72

Get sequence
Deep sequencing 15 reads, 5 experiments
Evidence by similarity; MI0003676
Predicted targets

References

1