Stem-loop sequence mml-mir-654

Accession MI0007898
Description Macaca mulatta miR-654 stem-loop
Gene family MIPF0000409; mir-654
Stem-loop
    aagugg    a      g c     a      - -  a 
gggu      aaag uggugg c gcaga caugug c ug g
||||      |||| |||||| | ||||| |||||| | ||  
cccg      uuuc acuacc g cgucu guauac g gc u
    --aaga    c      a u     -      c u  u 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MMUL1.0) Overlapping transcripts
7: 164324717-164324797 [+]
intergenic
Clustered miRNAs
< 10kb from mml-mir-654
mml-mir-543 7: 164316909-164316988 [+]
mml-mir-495 7: 164318758-164318839 [+]
mml-mir-376c 7: 164324189-164324254 [+]
mml-mir-376a-2 7: 164324567-164324646 [+]
mml-mir-654 7: 164324717-164324797 [+]
mml-mir-376b 7: 164324934-164325033 [+]
mml-mir-376a-1 7: 164325280-164325347 [+]
mml-mir-1185-2 7: 164327486-164327544 [+]
mml-mir-1185-1 7: 164328686-164328795 [+]
mml-mir-381 7: 164330417-164330491 [+]
mml-mir-487b 7: 164330952-164331035 [+]
mml-mir-539 7: 164331808-164331885 [+]
mml-mir-889 7: 164332385-164332463 [+]
mml-mir-544 7: 164333144-164333234 [+]
Database links

Mature sequence mml-miR-654-5p

Accession MIMAT0006495
Sequence

16 - 

uggugggccgcagaacaugugc

 - 37

Get sequence
Evidence by similarity; MI0003676
Predicted targets

Mature sequence mml-miR-654-3p

Accession MIMAT0006496
Sequence

51 - 

uaugucugcugaccaucaccuu

 - 72

Get sequence
Evidence by similarity; MI0003676
Predicted targets

References

1