Stem-loop sequence mml-mir-654

AccessionMI0007898
DescriptionMacaca mulatta miR-654 stem-loop
Gene family MIPF0000409; mir-654
Stem-loop
    aagugg    a      g c     a      - -  a 
gggu      aaag uggugg c gcaga caugug c ug g
||||      |||| |||||| | ||||| |||||| | ||  
cccg      uuuc acuacc g cgucu guauac g gc u
    --aaga    c      a u     -      c u  u 
Get sequence
Deep sequencing
2572 reads, 39.8 reads per million, 8 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CR_1.0) Overlapping transcripts
chr7: 164938642-164938722 [+]
intergenic
Clustered miRNAs
< 10kb from mml-mir-654
mml-mir-543chr7: 164930881-164930960 [+]
mml-mir-495chr7: 164932634-164932715 [+]
mml-mir-376cchr7: 164938114-164938179 [+]
mml-mir-376a-2chr7: 164938492-164938571 [+]
mml-mir-654chr7: 164938642-164938722 [+]
mml-mir-376bchr7: 164938859-164938958 [+]
mml-mir-376a-1chr7: 164939205-164939272 [+]
mml-mir-1185-2chr7: 164941410-164941468 [+]
mml-mir-1185-1chr7: 164942609-164942718 [+]
mml-mir-381chr7: 164944340-164944414 [+]
mml-mir-487bchr7: 164944875-164944958 [+]
mml-mir-539chr7: 164945731-164945808 [+]
mml-mir-889chr7: 164946308-164946386 [+]
mml-mir-544chr7: 164947069-164947159 [+]
Database links

Mature sequence mml-miR-654-5p

Accession MIMAT0006495
Sequence

16 - 

uggugggccgcagaacaugugc

 - 37

Get sequence
Deep sequencing3 reads, 2 experiments
Evidence by similarity; MI0003676
Predicted targets

Mature sequence mml-miR-654-3p

Accession MIMAT0006496
Sequence

51 - 

uaugucugcugaccaucaccuu

 - 72

Get sequence
Deep sequencing15 reads, 5 experiments
Evidence by similarity; MI0003676
Predicted targets

References

1