Stem-loop sequence mml-mir-653

AccessionMI0007897 (change log)
DescriptionMacaca mulatta miR-653 stem-loop
Gene family MIPF0000435; mir-653
Literature search

1 open access papers mention mml-mir-653
(3 sentences)

Stem-loop
   -----------u      cuu              u     c    ccagcu 
5'             ucauuc   caguguugaaacaa cucua ugaa      u
               ||||||   |||||||||||||| ||||| ||||      c
3'             aguaag   guuauaacuuuguu gaggu acuu      a
   cgaagguagaau      aac              u     c    aaacaa 
Get sequence
Deep sequencing
3498 reads, 28.6 reads per million, 7 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr3: 118802354-118802449 [-]
intergenic
Clustered miRNAs
< 10kb from mml-mir-653
mml-mir-489chr3: 118803460-118803543 [-]
mml-mir-653chr3: 118802354-118802449 [-]
Database links

Mature sequence mml-miR-653-5p

Accession MIMAT0006494
Sequence

13 - 

guguugaaacaaucucuacug

 - 33

Get sequence
Deep sequencing3192 reads, 7 experiments
Evidence experimental; Illumina [2]

Mature sequence mml-miR-653-3p

Accession MIMAT0026905
Sequence

51 - 

uucacuggaguuuguuucaaua

 - 72

Get sequence
Deep sequencing306 reads, 5 experiments
Evidence experimental; Illumina [2]
Predicted targets

References

1
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).