Stem-loop sequence mml-mir-652

Accession MI0007896
Description Macaca mulatta miR-652 stem-loop
Gene family MIPF0000333; mir-652
Stem-loop
ac aau  cua                  gagag           ca  g 
  g   gg   ugcacugcacaacccuag     ggugccauuca  ua a
  |   ||   ||||||||||||||||||     |||||||||||  || c
  c   cc   acgugacguguugggauc     ccgcgguaagu  au u
ca -gu  aac                  ----a           ua  a 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MMUL1.0) Overlapping transcripts
X: 108770393-108770490 [+]
sense
ENSMMUT00000047846 ; TMEM164-201; intron 2
ENSMMUT00000032119 ; TMEM164-202; intron 2
Database links

Mature sequence mml-miR-652

Accession MIMAT0006493
Sequence

61 - 

aauggcgccacuaggguugug

 - 81

Get sequence
Evidence by similarity; MI0003667
Predicted targets

References

1