Stem-loop sequence mml-mir-652

AccessionMI0007896 (change log)
DescriptionMacaca mulatta miR-652 stem-loop
Gene family MIPF0000333; mir-652
Stem-loop
   ac aau  cua                  gagag           ca  g 
5'   g   gg   ugcacugcacaacccuag     ggugccauuca  ua a
     |   ||   ||||||||||||||||||     |||||||||||  || c
3'   c   cc   acgugacguguugggauc     ccgcgguaagu  au u
   ca -gu  aac                  ----a           ua  a 
Get sequence
Deep sequencing
10776 reads, 22.2 reads per million, 9 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chrX: 104120060-104120157 [+]
sense
ENSMMUT00000001847 ; RGAG1-201; 3'UTR (exon 2)
Database links

Mature sequence mml-miR-652

Accession MIMAT0006493
Sequence

61 - 

aauggcgccacuaggguugug

 - 81

Get sequence
Deep sequencing10767 reads, 9 experiments
Evidence by similarity; MI0003667
Predicted targets

References

1