Stem-loop sequence mml-mir-651

Accession MI0007895
Description Macaca mulatta miR-651 stem-loop
Gene family MIPF0000478; mir-651
Stem-loop
   ---------     a   c         ga   a    ga       ucaaa 
5'          aagcu uca ugcuuuuua  aua gcuu  cuuuugu     u
            ||||| ||| |||||||||  ||| ||||  |||||||      
3'          uuuga agu acggaaaau  uau ugaa  gaaaacg     a
   uuuguauaa     c   a         uc   g    ag       caaaa 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence mml-miR-651

Accession MIMAT0006492
Sequence

16 - 

uuuagaauaagcuugacuuuug

 - 37

Get sequence
Evidence by similarity; MI0003666
Predicted targets

References

1