Stem-loop sequence mml-mir-650d

AccessionMI0007894
DescriptionMacaca mulatta miR-650d stem-loop
Gene family MIPF0000457; mir-650
Stem-loop
-ca     ----------     -cuc     a   u   gu    a   cu 
   gugcu          ggggu    aggag cag gcu  cggg cgu  c
   |||||          |||||    ||||| ||| |||  |||| |||  c
   cacgg          uccca    uccuc guc cgg  gucc gua  a
gga     aacucacucu     cucc     -   u   --    g   cc 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence mml-miR-650d

Accession MIMAT0006491
Sequence

16 - 

aggagacagugcugucgggac

 - 36

Get sequence
Evidence by similarity; MI0003665
Predicted targets

References

1