Stem-loop sequence mml-mir-650b

Accession MI0007892
Description Macaca mulatta miR-650b stem-loop
Gene family MIPF0000457; mir-650
Stem-loop
----ca     ----------     cuc      c    -c       a   cu 
      gugcu          ggggu   aggagg agcg  ucucggg cau  c
      |||||          |||||   |||||| ||||  ||||||| |||  c
      cacgg          uccca   uucucc ucgu  agggucc gua  a
agugga     gacucacucc     --c      -    cu       g   cc 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MMUL1.0) Overlapping transcripts
10: 66755812-66755906 [+]
sense
Database links

Mature sequence mml-miR-650b

Accession MIMAT0006489
Sequence

16 - 

aggaggcagcgcucucgggac

 - 36

Get sequence
Evidence by similarity; MI0003665
Predicted targets

References

1