Stem-loop sequence mml-mir-650b

AccessionMI0007892 (change log)
DescriptionMacaca mulatta miR-650b stem-loop
Gene family MIPF0000457; mir-650
Stem-loop
   ----ca     ----------     cuc      c    -c       a   cu 
5'       gugcu          ggggu   aggagg agcg  ucucggg cau  c
         |||||          |||||   |||||| ||||  ||||||| |||  c
3'       cacgg          uccca   uucucc ucgu  agggucc gua  a
   agugga     gacucacucc     --c      -    cu       g   cc 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
JSUE03147321.1: 535-629 [+]
sense
ENSMMUT00000011903 ; SPECC1L-201; intron 1
ENSMMUT00000011906 ; SPECC1L-202; intron 2
Database links

Mature sequence mml-miR-650b

Accession MIMAT0006489
Sequence

16 - 

aggaggcagcgcucucgggac

 - 36

Get sequence
Evidence by similarity; MI0003665
Predicted targets

References

1