Stem-loop sequence mml-mir-650b

AccessionMI0007892
DescriptionMacaca mulatta miR-650b stem-loop
Gene family MIPF0000457; mir-650
Stem-loop
----ca     ----------     cuc      c    -c       a   cu 
      gugcu          ggggu   aggagg agcg  ucucggg cau  c
      |||||          |||||   |||||| ||||  ||||||| |||  c
      cacgg          uccca   uucucc ucgu  agggucc gua  a
agugga     gacucacucc     --c      -    cu       g   cc 
Get sequence
Deep sequencing
3 reads, 0.486 reads per million, 3 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CR_1.0) Overlapping transcripts
chr10: 67714514-67714608 [+]
sense
ENSMMUT00000011903 ; SPECC1L-201; intron 1
ENSMMUT00000011906 ; SPECC1L-202; intron 2
Database links

Mature sequence mml-miR-650b

Accession MIMAT0006489
Sequence

16 - 

aggaggcagcgcucucgggac

 - 36

Get sequence
Evidence by similarity; MI0003665
Predicted targets

References

1