Stem-loop sequence mml-mir-650a-2

DescriptionMacaca mulatta miR-650a-2 stem-loop
Gene family MIPF0000457; mir-650
   ---------------cagugcu   aucuc     g   c    uca     ucuc 
5'                       ggg     aggag cag gcuc   ggacu    c
                         |||     ||||| ||| ||||   |||||     
3'                       ccc     uccuc guc cggg   ucugg    a
   aguggacacgggacucacuccu   acucc     -   u    ---     uacc 
Get sequence
Deep sequencing
1 reads, 0.0964 reads per million, 1 experiments
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence mml-miR-650a

Accession MIMAT0006488

16 - 


 - 36

Get sequence
Evidence by similarity; MI0003665
Predicted targets
