Stem-loop sequence mml-mir-650a-2

AccessionMI0007891
DescriptionMacaca mulatta miR-650a-2 stem-loop
Gene family MIPF0000457; mir-650
Stem-loop
---------------cagugcu   aucuc     g   c    uca     ucuc 
                      ggg     aggag cag gcuc   ggacu    c
                      |||     ||||| ||| ||||   |||||     
                      ccc     uccuc guc cggg   ucugg    a
aguggacacgggacucacuccu   acucc     -   u    ---     uacc 
Get sequence
Deep sequencing
1 reads, 0.0964 reads per million, 1 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence mml-miR-650a

Accession MIMAT0006488
Sequence

16 - 

aggaggcagcgcucucaggac

 - 36

Get sequence
Evidence by similarity; MI0003665
Predicted targets

References

1