Stem-loop sequence mml-mir-650a-2

Accession MI0007891
Description Macaca mulatta miR-650a-2 stem-loop
Gene family MIPF0000457; mir-650
Stem-loop
---------------cagugcu   aucuc     g   c    uca     ucuc 
                      ggg     aggag cag gcuc   ggacu    c
                      |||     ||||| ||| ||||   |||||     
                      ccc     uccuc guc cggg   ucugg    a
aguggacacgggacucacuccu   acucc     -   u    ---     uacc 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MMUL1.0) Overlapping transcripts
10: 66779630-66779724 [+]
sense
Database links

Mature sequence mml-miR-650a

Accession MIMAT0006488
Sequence

16 - 

aggaggcagcgcucucaggac

 - 36

Get sequence
Evidence by similarity; MI0003665
Predicted targets

References

1