Stem-loop sequence mml-mir-650a-1

AccessionMI0007890 (change log)
DescriptionMacaca mulatta miR-650a-1 stem-loop
Gene family MIPF0000457; mir-650
Stem-loop
   ----ca     -------    -ucuc      c    -cu      a   cu 
5'       gugcu       ggga     aggagg agcg   cucagg cgu  c
         |||||       ||||     |||||| ||||   |||||| |||  c
3'       cacgg       uccu     uccucc ucgu   gggucc gua  a
   agugga     gacucac    cccac      -    cuc      g   cc 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr10: 64625556-64625650 [+]
intergenic
Database links

Mature sequence mml-miR-650a

Accession MIMAT0006488
Sequence

16 - 

aggaggcagcgcucucaggac

 - 36

Get sequence
Evidence by similarity; MI0003665
Predicted targets

References

1