Stem-loop sequence mml-mir-650a-1

Accession MI0007890
Description Macaca mulatta miR-650a-1 stem-loop
Gene family MIPF0000457; mir-650
Stem-loop
   ----ca     -------    -ucuc      c    -cu     ga   cu 
5'       gugcu       ggga     aggagg agcg   cucag  cgu  c
         |||||       ||||     |||||| ||||   |||||  |||  c
3'       cacgg       uccu     uccucc ucgu   ggguc  gua  a
   agugga     gacucac    cccac      -    cuc     ug   cc 
Get sequence
Deep sequencing
2 reads, 0.245 reads per million, 2 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence mml-miR-650a

Accession MIMAT0006488
Sequence

16 - 

aggaggcagcgcucucaggac

 - 36

Get sequence
Evidence by similarity; MI0003665
Predicted targets

References

1