Stem-loop sequence mml-mir-650a-1

Accession MI0007890
Description Macaca mulatta miR-650a-1 stem-loop
Gene family MIPF0000457; mir-650
Stem-loop
----ca     -------    -ucuc      c    -cu     ga   cu 
      gugcu       ggga     aggagg agcg   cucag  cgu  c
      |||||       ||||     |||||| ||||   |||||  |||  c
      cacgg       uccu     uccucc ucgu   ggguc  gua  a
agugga     gacucac    cccac      -    cuc     ug   cc 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MMUL1.0) Overlapping transcripts
10: 66813986-66814080 [+]
sense
Database links

Mature sequence mml-miR-650a

Accession MIMAT0006488
Sequence

16 - 

aggaggcagcgcucucaggac

 - 36

Get sequence
Evidence by similarity; MI0003665
Predicted targets

References

1