|
miRBase |
|
Stem-loop sequence mml-mir-649 |
|||||
| Accession | MI0007889 | ||||
| Description | Macaca mulatta miR-649 stem-loop | ||||
| Gene family | MIPF0000547; mir-649 | ||||
| Stem-loop |
gccc c a u -- uau uu --gaaaa u
uagc aa uac gu auuuuu caacau gguu aca c
|||| || ||| || |||||| |||||| |||| |||
gucg uu gug cg ugagaa guugug ccaa ugu u
---- u c u cc cuu -u augauua g
|
||||
| Genome context |
|
||||
| Database links |
|
||||
Mature sequence mml-miR-649 |
|
| Accession | MIMAT0006487 |
| Sequence |
61 - aaaccuguguuguucaagaguc - 82 |
| Evidence | by similarity; MI0003664 |
| Predicted targets |
|
References |
|
| 1 |
PMID:18186931
"Identification of novel homologous microRNA genes in the rhesus macaque genome"
BMC Genomics. 9:8(2008).
|