Stem-loop sequence mml-mir-649

AccessionMI0007889
DescriptionMacaca mulatta miR-649 stem-loop
Gene family MIPF0000547; mir-649
Stem-loop
gccc    c  a   u  --      uau      uu    --gaaaa   u 
    uagc aa uac gu  auuuuu   caacau  gguu       aca c
    |||| || ||| ||  ||||||   ||||||  ||||       |||  
    gucg uu gug cg  ugagaa   guugug  ccaa       ugu u
----    u  c   u  cc      cuu      -u    augauua   g 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence mml-miR-649

Accession MIMAT0006487
Sequence

61 - 

aaaccuguguuguucaagaguc

 - 82

Get sequence
Evidence by similarity; MI0003664
Predicted targets

References

1