Stem-loop sequence mml-mir-643

Accession MI0007886
Description Macaca mulatta miR-643 stem-loop
Gene family MIPF0000488; mir-643
Stem-loop
   ---a   acugauacg  u       g                 a   gg  u 
5'     cca         ca uaucuac ugagcuagaauacaagu guu  ug c
       |||         || ||||||| ||||||||||||||||| |||  ||  
3'     ggu         gu auagaug acucgaucuuauguuca cag  ac u
   aaaa   -------aa  c       g                 -   ag  u 
Get sequence
Deep sequencing
1 reads, 0.0964 reads per million, 1 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence mml-miR-643

Accession MIMAT0006484
Sequence

61 - 

acuuguauucuagcucagguag

 - 82

Get sequence
Evidence by similarity; MI0003658
Predicted targets

References

1