Stem-loop sequence mml-mir-643

Accession MI0007886
Description Macaca mulatta miR-643 stem-loop
Gene family MIPF0000488; mir-643
Stem-loop
---a   acugauacg  u       g                 a   gg  u 
    cca         ca uaucuac ugagcuagaauacaagu guu  ug c
    |||         || ||||||| ||||||||||||||||| |||  ||  
    ggu         gu auagaug acucgaucuuauguuca cag  ac u
aaaa   -------aa  c       g                 -   ag  u 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MMUL1.0) Overlapping transcripts
19: 58324981-58325077 [+]
intergenic
Database links

Mature sequence mml-miR-643

Accession MIMAT0006484
Sequence

61 - 

acuuguauucuagcucagguag

 - 82

Get sequence
Evidence by similarity; MI0003658
Predicted targets

References

1